A relative quantitative method to detect OCT4A gene expression by exon-junction primer and locked nucleic acid-modified probe

A relative quantitative method to detect OCT4A gene expression by exon-junction primer and locked nucleic acid-modified probe 1 2 first-author 1 2 corresp ‡Corresponding Author ‡Corresponding Author †E-mail:Mengxingkai001@163.com †E-mail:Mengxingkai001@163.com Mengxingkai001@163.com Department of General Surgery, Xuanwu Hospital, Capital Medical University, Beijing 100053, China Department of General Surgery, Xuanwu Hospital, Capital Medical University, Beijing 100053, China Department of General Surgery, Affiliated Hospital of Inner Mongolia Medical College, Hohhot 010050, China Department of General Surgery, Affiliated Hospital of Inner Mongolia Medical College, Hohhot 010050, China Objective: 2 OCT4A has been known to play a critical role in the maintenance of pluripotency of embryonic stem cells. Recent research has shown that OCT4A is also expressed in partial tumor cell lines and tissues. This study is aimed to develop a real-time reverse transcriptase polymerase chain reaction (RT-PCR) assay for relative quantitative detection of OCT4A mRNA and discrimination from OCT4B , pseudogene, and genomic contaminations. Methods: 2 A locked nucleic acid (LNA)-modified probe was designed to discern the single base difference 352A/C to identify OCT4A mRNA. An exon-junction primer was designed to avoid false positive caused by genomic contaminations. In addition, a house keeping gene glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) was measured in parallel to normalize the differences between samples and operations. Results: 2 Experiments showed that the newly established RT-PCR assay amplified the OCT4A mRNA selectively; OCT4A analogues gave negative signals. Cell lines nTERA-2 and HepG2 showed positive results in OCT4A expression, while for HeLa and 293 cell lines, as well as primary peripheral blood mononuclear cells (PBMCs), OCT4A expression was negative. Additionally, the relative quantity of OCT4A mRNA was calculated by cycle threshold ( C t ) method and house keeping gene normalization. Conclusions: 2 This technique proved to be effective for relative quantitation of OCT4A mRNA with high specificity. OCT4A Locked nucleic acid (LNA) Real-time polymerase chain reaction (PCR) Introduction 1 Octamer-4 (Oct-4A) is a member of the POU family of transcription factors and is expressed in both embryonic stem (ES) cells and embryonal carcinoma (EC) cells. When cells are driven into embryonic and extraembryonic somatic differentiation, they lose Oct-4A expression (Takeda et al., 1992 1992 ; Preston et al., 2003 2003 ; Zangrossi et al., 2007 2007 ). The human Oct-4 gene, located on chromosome 6p21.31, is alternatively spliced, encoding OCT4A and OCT4B . OCT4A confers the stemness properties of ES cells and is critically involved in the self-renewal of undifferentiated ES cells, whereas the function of OCT4B is unknown (Scholer et al., 1989 1989 ; Kerkis et al., 2006 2006 ; Medvedev et al., 2008 2008 ). The basic local alignment search tool (BLAST) search results showed that the coding region of OCT4A exon 1 had high homology with human POU5F1B mRNA. The sequence homologous rate of nucleotide was 96%. At genomic level it also had high homology with fragments of chromosomes 1 and 12, which seem as OCT4A pseudogene. The homologous rates were 95% and 97%, respectively. Recent reports have described OCT4A expression in several human tumor cell lines. Reactivation of OCT4A expression is postulated to occur in differentiated cells that have undergone carcinogenesis, or tumor formation (Looijenga et al., 2003 2003 ; Suo et al., 2005 2005 ; Cantz et al., 2008 2008 ). To resolve the apparent discrepancy in OCT4A expression between earlier and recent studies concerning whether OCT4A is specifically expressed in ES cells and in tumor cells, but not in cells of differentiated tissues, we designed a method to differentiate between Oct-4A and Oct-4B , OCT4A pseudogene expression at mRNA level. In addition, the method can avoid false positive caused by contaminated genomic DNA. Materials and methods 1 Principle of quantitative measurement of OCT4A expression 2 OCT4A has 5 exons and 4 introns, and only exon 1 is special. Its exons 2, 3, 4, and 5 are exactly the same as OCT4B (Fig. 1 1 ). Sequence analysis has shown that the coding region of OCT4A exon 1 contains some special sites, namely 234C and 352A, which are different from POU5F1B mRNA and other OCT4A pseudogene sequences (Fig. 2 2 ). This difference was exploited to create assays selective for OCT4A expression. Our strategy is shown in Fig. 3 3 . Firstly, a pair of primers was designed. Forward primer P1 was complementary to OCT4A exon 1. Reverse primer was design as exon-bridge primer P2, which is composed of two segments (segment A near 3′ end is complementary to OCT4A exon 1 end sequence, segment B near 5′ end is complementary to OCT4A exon 2 beginning sequence). Thus, in reverse transcriptase polymerase chain reaction (RT-PCR) reaction system (Nolan et al., 2006 2006 ), exon-bridge primer only pairs with transcript mRNA, and the genomic sequence cannot be amplified. In addition, a fluorogenic locked nucleic acid (LNA)-modified probe P3 (FAM-caggggTGacggtg-BHQ1) was designed to identify base divergence 352A/C site, which can differentiate OCT4A mRNA from OCT4B and OCT4A pseudogene expressions. Taq polymerase 5′-nuclease activity enables the system to amplify fluorescence with the accumulation of specific PCR product. Real-time quantitative PCR eliminates the variability associated with conventional PCR, thus allowing routine and reliable quantitation of nucleotide templates. In order to test and verify this novel strategy, we also designed another two pairs of primers, which were used in conventional PCR and RT-PCR as comparison. One primer set was composed of exon-bridge primer P2 and forward primer P1, another primer set was composed of P4 and P5, each of which was complementary to OCT4A exon 1 region. These primer sites and sequences are listed in Table 1 1 . The coding region of OCT4A exon 1 had high homology with human POU5F1B mRNA and fragments of chromosomes 1 and 12. Red arrow shows the key different sites Exons 1, 2, 3, 4, 5 are indicated. The forward primer is on exon 1, which is between CDS 266 and 285; the reverse primer is spanning the junction between exons 1 and 2, and has six base pairs on exon 1 at the 3′ end, which is between CDS 419 and 400; the probe is on exon 1, which has a special 352A site different from POU5F1B and other similar genes, which are all 352C Locked nucleic acid-modified site Primer and probe names Sequence P1 gcttggagacctctcagcct P2 ttgatgtcctgggactcctc P3 FAM-caggggT # # G # # acggtg-BHQ1 P4 TCGGACCTGGCTAAGCTTCC P5 TGCTCCAGCTTCTCCTTCTCC H- GAPDH -1 TGAGCACCAGGTGGTCTCC H- GAPDH -2 TAGCCAAATTCGTTGTCATACCAG H- GAPDH -3 FAM-ACAGCGACACCCACTCCTCCA CC-BHQ1 Construct simulation models of OCT4A , OCT4B , and two OCT4A pseudogenes 2 Clones of OCT4A , OCT4B , and two OCT4A pseudogenes were constructed by a two-step PCR-based gene synthesis method. Based on sequence in GenBank data, we synthesized overlapping oligonucleotides which, when assembled, formed the template for the gene of interest (Fig. 4 4 ). Synthesized overlapping oligonucleotides were assembled by complementary base pairing. The blue and red boxes represent complementary nucleotide bases, respectively Gene assembly and amplification 3 We mixed the equal volumes of oligonucleotide solutions, which were then diluted with water to get a final concentration of ~1 ng/µl for each. Diluting the oligonucleotide mixture with PCR solution for five-fold. The final concentrations of components were 0.2 ng/µl for each oligonucleotide, 20 mmol/L for Tris-HCl (pH 8.8), 10 mmol/L for KCl, 10 mmol/L for (NH 4 ) 2 SO 4 , 6 mmol/L for MgSO 4 , 0.1% (v/v) for Triton X-100, 0.1 mg/ml for bovine serum albumin, 0.2 mmol/L for each dNTP, and 2.5 U for Pfu polymerase. In the PCR protocol, we added the polymerase to avoid any possible mispriming, which meant hot start PCR in gene assembly, which began with one 5-min denaturation step of 95 °C, then 25 cycles of denaturation temperature 95 °C for 30 s, variable annealing temperature for 30 s, and extension temperature of 72 °C for 1.5 min. In the PCR protocol, the last step was an incubation cycle at 72 °C for 10 min. The template will be 1 µl of the mixture resulting from the gene assembly reaction, and the primer will be the outermost oligonucleotides for the gene amplification. In the PCR protocol, the gene amplification is the same as gene assembly in essence, and only the annealing temperature is different (raised to 62 °C). Cloning and sequencing 3 We integrated the synthetic gene fragments which were purified by gel extraction into the vector using the TA cloning system. The ligation products were transformed into DH5α Escherichia coli cells and selected on Luria-Bertani (LB) medium plates with 50 µg/ml ampicillin. The plasmids isolated were screened by PCR using primers complementary to vector sequences flanking the synthetic gene, and plasmids containing the gene of interest were sequenced in both the forward and reverse directions. In vitro transcription 3 After clones of interest were validated, they were linearized by restriction enzyme digestion, followed by double extraction with phenol: chloroform (1:1, v/v) and single extraction with chloroform. Sodium acetate (0.3 mol/L) was added and nucleic acid was precipitated with 0.75 ml of isopropanol. The precipitate was dissolved in 100 µl TE solution (10 mmol/L Tris-HCl (pH 8.0), 1 mmol/L ethylenediaminetetraacetic acid (EDTA)). T7 transcription kit was used to amplify the target gene RNA. The procedures were largely based on the vendor’s protocol. Sample preparation 2 Cell lines nTERA-2, HepG2, HeLa, and 293 were obtained from the ATCC. Cells were thawed and plated into six-well culture dishes (Corning, Shanghai, China) without a feeder layer. The growth medium used was Dulbecco’s modified Eagle medium (DMEM). Cells were cultured at 37 °C and 5% CO 2 , and the medium was replaced every 24 h. Cultured cells (5×10 5 –1×10 6 cells) were collected by trypsinization and washed with phosphate-buffered saline (PBS). Peripheral blood mononuclear cells (PBMCs) were isolated by FICOLL (Sigma, Shanghai, China). RNA extraction 3 A total of 1 ml of TRIzol was added to a cell pellet. After resuspending the cells, the tubes were vigorously shaken at room temperature for 1 min. Immediately after, the samples were added to 200 μl chloroform, shaken, and stored at room temperature for 5 min; the extraction mix was centrifuged for 15 min at 12 000× g in 4 °C to promote phase separation. The aqueous phase was then retrieved and mixed with an equal volume of isopropanol, incubated at room temperature, and centrifuged to concentrate the precipitated RNA. The RNA pellet was washed using 75% ethanol, then air-dried, and finally dissolved in diethylpyrocarbonate (DEPC) water. Genome DNA extraction 3 Purification of cell genome DNA was carried out using the DNeasy Blood & Tissue kit (Qiagen, Hilden, Germany). Especially, RNase A should be added to the sample before addition of buffer AL (Qiagen). Other procedures were largely followed the vendor’s protocol. Relative quantification of OCT4A gene expression 2 Conventional PCR 3 Conventional PCR system was 50 µl volume reaction containing 5 µl 10× PCR reaction buffer, 0.5 µmol/L each forward and reverse primer, 200 nmol/L each of dATP, dTTP, dGTP, and dCTP, 50 nmol/L dUTP, 1.5 U HotStarTaq DNA polymerase (Qiagen), 0.5 U of uracil N -glycosylase (UNG), and 5 µl template. Cycle parameters were 37 °C for 2 min, 95 °C for 15 min, and 35 cycles of 94 °C for 15 s, 58 °C for 20 s, and 72 °C for 30 s. Reaction was carried out in a 9600 PerkinElmer apparatus (PerkinElmer, USA). Conventional RT-PCR 3 Conventional RT-PCR system was 25 µl volume reaction containing 12.5 µl 2× RT-PCR reaction buffer, 0.5 µmol/L each forward primer and reverse primer, 200 nmol/L each dATP, dTTP, dGTP, and dCTP, 1.5 U HotStarTaq DNA polymerase, 200 U Super Script III reverse transcriptase, and 5 µl template. Cycle parameters were 45 °C for 15 min, 95 °C for 15 min, and 35 cycles at of 94 °C for 15 s, 58 °C for 20 s, and 72 °C for 30 s. Real-time fluorescence RT-PCR 3 Real-time fluorescence RT-PCR system was 20 µl volume reaction containing 10 µl 2× real-time RT-PCR reaction buffer, 0.5 µmol/L primer P1 and P2, 0.25 µmol/L of TaqMan LNA probe, 200 nmol/L each dATP, dTTP, dGTP, and dCTP, 1.5 U HotStarTaq DNA polymerase, 200 U Super Script III reverse transcriptase, and 2 µl template. Cycle parameters were 45 °C for 15 min, 95 °C for 15 min, and 40 cycles at 94 °C for 5 s and 60 °C for 25 s. Fluorescence value of each tube was measured at the end of 60 °C step. House keeping gene glyceraldehyde-3-phosphate dehydrogenase ( GAPDH ) was measured in parallel, which was used as the internal control to normalize the difference (Kheirelseid et al., 2010 2010 ). Results 1 Construct simulation models of OCT4A , OCT4B , and two OCT4A pseudogenes 2 Sequencing data (in both the forward and reverse directions) validated that four gene fragments had been cloned into the PUCm18 T vectors separately. These clones were named as PUCm18- OCT4A , PUCm18- OCT4B , PUCm18- OCT4a1 , and PUCm18- OCT4a2 . These four inserted sequences were compared by software ClustalX 1.81 and BioEdit 7.09. OCT4A exon 1 had three special sites 48T, 234C, and 352A, different from other three sequences. These plasmids were diluted in 1:100 000 with TE solution, and used as templates in the following PCR reaction. After in vitro transcription, the products for each plasmid were diluted in 1:100 000 by DEPC pure water, and then were used as templates in the next RT-PCR reaction. Specificity of the method for OCT4A expression 2 To evaluate whether the novel strategy can detect selectively OCT4A expression from other similar forms, namely OCT4B and OCT4A pseudogenes, conventional PCR and RT-PCR were used for comparison. Conventional PCR (P1, P2 as primer sets) showed that genomic DNA as template gave a negative result (Fig. 5b 5b ), meanwhile they were positive (Fig. 5a 5a ) in another conventional PCR (P5, P6 as primer sets). It means that the junction primer P2 contributed to avoiding the false positive caused by genomic DNA. This hypothesis went a step further. In conventional RT-PCR (P1, P2 as primer sets), nTERA-2, HepG2, HeLa cell RNA extractions gave a positive result, PBMC and 293 cells were negative (Fig. 5d 5d ). However, in another RT-PCR (P5, P6 as primer sets), these cell RNA showed weak positive (Fig. 5c 5c ). It means that the amplification products of HepG2 and HeLa cells in conventional RT-PCR (P1, P2 as primer sets) were really from transcription RNA, not contaminated genomic DNA. Furthermore, among four simulation transcription models, only OCT4A model gave a positive signal (Fig. 6a 6a ) in real-time RT-PCR (P1, P2 as primers; P3 as probe). Considering other experiment (Fig. 5d 5d ), it meant that LNA-modified probe discriminate OCT4A mRNA from other similar transcription forms. In addition, we found that HeLa cell RNA gave a negative result in real-time RT-PCR, while nTERA-2 and HepG2 were positive (Fig. 6b 6b ). (a) Conventional PCR (P5, P6 as primer sets); (b) Conventional PCR (P1, P2 as primer sets). Lanes 1–4: plasmid dilution as PCR amplification templates. They were PUCm18- OCT4A , PUCm18- OCT4B , PUCm18- OCT4a1 , and PUCm18- OCT4a2 , respectively; Lanes 5–9: genomic DNA extraction as PCR templates. They were nTERA-2, HepG2, 293, HeLa, and PBMC, respectively; (c) Conventional RT-PCR (P5, P6 as primer sets); (d) Conventional RT-PCR (P1, P2 as primer sets). Lanes 1–4: in vitro transcription RNA as RT-PCR amplification templates. They were from plasmid PUCm18- OCT4A , PUCm18- OCT4B , PUCm18- OCT4a1 , and PUCm18- OCT4a2 , respectively. Lanes 5–9: RNA extraction as RT-PCR templates. They were nTERA-2, HepG2, 293, HeLa, and PBMC, respectively 1: PUCm18- OCT4A in vitro transcription RNA as real-time RT-PCR amplification template; 2–4: in vitro transcription RNA as real-time RT-PCR amplification templates. They were from plasmid PUCm18- OCT4B , PUCm18- OCT4a1 , and PUCm18- OCT4a2 , respectively; 5–9: RNA extraction as RT-PCR templates. They were nTERA-2, HepG2, HeLa, 293, and PBMC, respectively Relative quantification of OCT4A gene expression 2 Relative quantification is the most widely adopted approach. Quantification of gene expression is based on the analysis of a target gene whose expression is normalized relative to the expression of a control gene. In our study, GAPDH gene was used as house-keeping gene. OCT4 gene relative quantization data are shown in Table 2 2 . Data are expressed as mean±standard deviation (SD) The Δ C t value was determined by subtracting the average GAPDH C t value from the average OCT4A C t value ( C t ( OCT4A )− C t ( GAPDH )) The calculation of ΔΔ C t was arbitrary constant, so the standard deviation of ΔΔ C t was same as the standard deviation of Δ C t (Δ C t ( OCT4A )−Δ C t (nTERA-2)) The range given for OCT4A mRNA relative to nTERA-2 cell line was determined by evaluating the expression: 2 −ΔΔ C t with ΔΔ C t ±SD ND: undetectable; −: negative Cells Average OCT4A C t Average GAPDH C t Δ C t a a ΔΔ C t b b OCT4A /nTERA-2 c c nTERA-2 26.85±0.15 19.76±0.07 7.09±0.18 0.00±0.18 1 HepG2 29.71±0.17 20.32±0.10 9.39±0.21 2.30±0.21 0.176–0.235 293 ND 21.67±0.09 − − − HeLa ND 19.35±0.09 − − − Discussion 1 The ability to relatively quantify mRNA represents a major step forward in tissue transcript analysis, but for OCT4A gene, the key and the greatest difficulty is to distinguish the false appearances from pseudogenes, other transcripts, and genomic contaminations. It is really important to detect the OCT4A mRNA accurately for learning the expression state for OTC4A in tissues, cell lines, and many kinds of tumor and series of cell differentiation stage. It is an important method of defining the function of this gene. Detection of single base substitution using a high affinity DNA analogue known as LNA for allelic discrimination assays has been achieved by various methods (Braasch and Corey, 2001 2001 ; Petersen et al., 2003 2003 ). Real-time PCR has been investigated as a platform to perform SNP genotyping with the utilization of LNA/DNA duplexes (Johnson et al., 2004 2004 ). Based on the results, we found that using exon-junction primer can avoid the false positive result caused by the genomic contaminations in the process of RNA sample extraction. LNA probe can discriminate the OCT4A mRNA and OCT4B mRNA and pseudogenes mRNA at a transcript level. Moreover, adopting a house keeping gene as internal control, it can revise the cell amount difference among the samples and the nucleic acid extraction yield difference. We can then study the OCT4A mRNA relative expression amount among different tissues and cell samples. In summary, our method is capable of detecting the OCT4A expression at a quantitative level, thus facilitating further study of OCT4A function. References DA Braasch , DR Corey . Locked nucleic acid (LNA): fine-tuning the recognition of DNA and RNA . Chem Biol , 2001 . 8 ( 1 ): 1 - 7 . 11182314 DOI: 10.1016/S1074-5521(00)00058-2 http://doi.org/10.1016/S1074-5521(00)00058-2 . Locked nucleic acid (LNA): fine-tuning the recognition of DNA and RNA T Cantz , G Key , M Bleidissel , L Gentile , DW Han , A Brenne , HR Schöler . Absence of OCT4 expression in somatic tumor cell lines . Stem Cells , 2008 . 26 ( 3 ): 692 - 697 . 18032701 DOI: 10.1634/stemcells.2007-0657 http://doi.org/10.1634/stemcells.2007-0657 . Absence of OCT4 expression in somatic tumor cell lines MP Johnson , LM Haupt , LR Griffiths . Locked nucleic acid (LNA) single nucleotide polymorphism (SNP) genotype analysis and validation using real-time PCR . Nucleic Acids Res , 2004 . 32 ( 6 ): e55 15047860 DOI: 10.1093/nar/gnh046 http://doi.org/10.1093/nar/gnh046 . Locked nucleic acid (LNA) single nucleotide polymorphism (SNP) genotype analysis and validation using real-time PCR I Kerkis , A Kerkis , D Dozortsev , GC Stukart-Parsons , SM Gomes Massironi , LV Pereira , AI Caplan , HF Cerruti . Isolation and characterization of a population of immature dental pulp stem cells expressing OCT-4 and other embryonic stem cell markers . Cells Tissues Organs , 2006 . 184 ( 3-4 ): 105 - 116 . 17409736 DOI: 10.1159/000099617 http://doi.org/10.1159/000099617 . Isolation and characterization of a population of immature dental pulp stem cells expressing OCT-4 and other embryonic stem cell markers EA Kheirelseid , KH Chang , J Newell , MJ Kerin , N Miller . Identification of endogenous control genes for normalisation of real-time quantitative PCR data in colorectal cancer . BMC Mol Biol , 2010 . 11 ( 1 ): 12 20122155 DOI: 10.1186/1471-2199-11-12 http://doi.org/10.1186/1471-2199-11-12 . Identification of endogenous control genes for normalisation of real-time quantitative PCR data in colorectal cancer LH Looijenga , H Stoop , HP de Leeuw , CA de Gouveia Brazao , AJ Gillis , KE van Roozendaal , EJ van Zoelen , RF Weber , KP Wolffenbuttel , H van Dekken , 等 . POU5F1 (OCT3/4) identifies cells with pluripotent potential in human germ cell tumors . Cancer Res , 2003 . 63 2244 - 2250 . 12727846 . POU5F1 (OCT3/4) identifies cells with pluripotent potential in human germ cell tumors SP Medvedev , AI Shevchenko , EA Elisaphenko , TB Nesterova , N Brockdorff , SM Zakian . Structure and expression pattern of Oct4 gene are conserved in vole Microtus rossiaemeridionalis . BMC Genomics , 2008 . 9 ( 1 ): 162 18402712 DOI: 10.1186/1471-2164-9-162 http://doi.org/10.1186/1471-2164-9-162 . Structure and expression pattern of Oct4 gene are conserved in vole Microtus rossiaemeridionalis T Nolan , RE Hands , SA Bustin . Quantification of mRNA using real-time RT-PCR . Nat Protoc , 2006 . 1 ( 3 ): 1559 - 1582 . 17406449 DOI: 10.1038/nprot.2006.236 http://doi.org/10.1038/nprot.2006.236 . Quantification of mRNA using real-time RT-PCR M Petersen , J Wengel , M Petersen , J Wengel . LNA: a versatile tool for therapeutics and genomics . Trends Biotechnol , 2003 . 21 ( 2 ): 74 - 81 . 12573856 DOI: 10.1016/S0167-7799(02)00038-0 http://doi.org/10.1016/S0167-7799(02)00038-0 . LNA: a versatile tool for therapeutics and genomics SL Preston , MR Alison , SJ Forbes , NC Direkze , R Poulsom , NA Wright . The new stem cell biology: something for everyone . Mol Pathol , 2003 . 56 ( 2 ): 86 - 96 . 12665626 DOI: 10.1136/mp.56.2.86 http://doi.org/10.1136/mp.56.2.86 . The new stem cell biology: something for everyone HR Scholer , AK Hatzopoulos , R Balling , N Suzuki , P Gruss . A family of octamer-specific proteins present during mouse embryogenesis: evidence for germline-specific expression of an Oct factor . EMBO J , 1989 . 8 ( 9 ): 2543 - 2550 . 2573523 . A family of octamer-specific proteins present during mouse embryogenesis: evidence for germline-specific expression of an Oct factor G Suo , J Han , X Wang , J Zhang , Y Zhao , J Dai . Oct4 pseudogenes are transcribed in cancers . Biochem Biophys Res Commun , 2005 . 337 ( 4 ): 1047 - 1051 . 16229821 DOI: 10.1016/j.bbrc.2005.09.157 http://doi.org/10.1016/j.bbrc.2005.09.157 . Oct4 pseudogenes are transcribed in cancers J Takeda , S Seino , GI Bell . Human Oct3 gene family cDNA sequences, alternative splicing, gene organization, chromosomal location, and expression at low levels in adult tissues . Nucleic Acids Res , 1992 . 20 ( 17 ): 4613 - 4620 . 1408763 DOI: 10.1093/nar/20.17.4613 http://doi.org/10.1093/nar/20.17.4613 . Human Oct3 gene family cDNA sequences, alternative splicing, gene organization, chromosomal location, and expression at low levels in adult tissues S Zangrossi , M Marabese , M Broggini , R Giordano , M D′Erasmo , E Montelatici , D Intini , A Neri , M Pesce , P Rebulla , 等 . Oct-4 expression in adult human differentiated cells challenges its role as a pure stem cell marker . Stem Cells , 2007 . 25 ( 7 ): 1675 - 1680 . 17379765 DOI: 10.1634/stemcells.2006-0611 http://doi.org/10.1634/stemcells.2006-0611 . Oct-4 expression in adult human differentiated cells challenges its role as a pure stem cell marker 10.1631/jzus.B1000110 Project (No. 2010036) supported by the program of “Medical Healthcare and Scientific Study” of the Ministry of Health, Inner Mongolia, China 2010-03-28 2010-12-31 2010-08-08 2022-01-05 Copyright © Zhejiang University and Springer-Verlag Berlin Heidelberg 2011 2011 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 02 12