Assessment of genetic diversity by simple sequence repeat markers among forty elite varieties in the germplasm for malting barley breeding

Assessment of genetic diversity by simple sequence repeat markers among forty elite varieties in the germplasm for malting barley breeding first-author corresp ‡Corresponding Author ‡Corresponding Author †E-mail:jmyang@163.comtao_yuezhi@hotmail.com †E-mail:jmyang@163.comtao_yuezhi@hotmail.com jmyang@163.com corresp ‡Corresponding Author ‡Corresponding Author †E-mail:jmyang@163.comtao_yuezhi@hotmail.com †E-mail:jmyang@163.comtao_yuezhi@hotmail.com jmyang@163.com Institute of Crop and Nuclear Technology Utilization, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China Institute of Crop and Nuclear Technology Utilization, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, China The genetic diversity and relationship among 40 elite barley varieties were analyzed based on simple sequence repeat (SSR) genotyping data. The amplified fragments from SSR primers were highly polymorphic in the barley accessions investigated. A total of 85 alleles were detected at 35 SSR loci, and allelic variations existed at 29 SSR loci. The allele number per locus ranged from 1 to 5 with an average of 2.4 alleles per locus detected from the 40 barley accessions. A cluster analysis based on the genetic similarity coefficients was conducted and the 40 varieties were classified into two groups. Seven malting barley varieties from China fell into the same subgroup. It was found that the genetic diversity within the Chinese malting barley varieties was narrower than that in other barley germplasm sources, suggesting the importance and feasibility of introducing elite genotypes from different origins for malting barley breeding in China. Barley ( Hordeum vulgare L.) Genetic similarity Simple sequence repeat (SSR) marker Cluster analysis Genetic diversity Introduction 1 Barley ( Hordeum vulgare L.) is the major raw material for malting and brewing. Therefore, barley grain and malting qualities are critical in their commercial use. Breeding of new malting barley varieties is a complex program that involves the improvement of at least 20 agronomic and malting characteristics (Rasmusson and Phillips, 1997 1997 ). This program normally restricts the use of parents in improving a variety of traits, and barley breeders have had to work within narrow gene pools (Horsley et al., 1995 1995 ). The modern malting barley cultivars are becoming more genetically homogeneous and more vulnerable to pathogens and adverse environments (Asins and Carbonell, 1989 1989 ). This threat has stimulated the study for new genetic resources for barley breeding, and more researchers in many countries have placed emphasis on the necessity for the collection, conservation, and utilization of the landrace and cultivated varieties (Brown et al., 1990 1990 ). It has been reported that there were 470 470 barley accessions in the GenBank (FAO, 2009 2009 ). Although a wide range of genetic resources is available in the GenBank, only a small part of these resources have been evaluated (Matus and Hayes, 2002 2002 ). Traditionally, morphological traits, cytological characters, biochemical tests, and pedigree information are used to assess genetic diversity and classify barley germplasm. However, these methods are always associated with various limitations and are insufficient to reveal the whole information within barley resources (Matus and Hayes, 2002 2002 ). Many types of molecular markers, including restriction fragment length polymorphism (RFLP), random amplified polymorphic DNA (RAPD), amplified fragment length polymorphism (AFLP), simple sequence repeat (SSR), and inter-simple sequence repeat (ISSR), have been used to characterize crop resources (Liu et al., 1996 1996 ; Russell et al., 1997 1997 ; Pejic et al., 1998 1998 ; Shi et al., 2004 2004 ; Reddy et al., 2009 2009 ). SSR markers, an excellent molecular marker system with the advantages of being codominant, abundant, highly reproducible, highly polymorphic, and easy to assay, have been used in many types of genetic analyses such as the construction of linkage maps, diversity assessment of germplasm, and identification of molecular markers for marker-assisted selection (Matus and Hayes, 2002 2002 ; Marcel et al., 2007 2007 ; Pushpendra et al., 2007 2007 ). Quantitative trait locus (QTL) analysis of malting quality has been performed in recent years on a number of crosses derived from different germplasm sources originating from North America, Europe, and Australia, and significant advances in knowledge have been achieved (Zale et al., 2000 2000 ; Hoffman and Dahleen, 2002 2002 ; Li et al., 2003 2003 ; Emebiri et al., 2004 2004 ; Marcel et al., 2007 2007 ; Panozzo et al., 2007 2007 ; Varshney et al., 2007 2007 ). The breeding of improved malting barley varieties to meet a stable, increasing demand of beer consumption is becoming a significant challenge for barley researchers and breeders in China. The genetic bases and relationships among different genotypes selected for malting barley breeding are, however, still unclear. In this study, we used 35 previously mapped SSR markers to characterize 40 barley accessions, including some parental lines of several mapping populations and elite genotypes of interest to our malting barley breeding program. The objectives of this study were: (1) to distinguish these genotypes, (2) to estimate the genetic diversity and relationship among these barley resources, and (3) to provide useful information for the conservation of genetic resources and the enhancement of malting barley breeding. Materials and methods 1 Barley varieties 2 Forty barley varieties were chosen for this study (Table 1 1 ). Among these accessions, 12 are malting barley varieties released in recent years in China, and 28 are cultivated barley varieties collected from different countries, including the parental lines of several mapping populations and some commercial varieties imported to China as malting barley. /: first cross; //: second cross; /3/: third cross; /4/: forth cross; M: mutation Barley variety Origin Row-type Type Pedigree  Baudin Australia 2 Spring Stirling/Franklin  Sloop Australia 2 Spring WI2468/Norbert//Golden Promise/WI2395/3/Schooner  Stirling Australia 2 Spring Dampier//(A-14)Prior/Ymer/3/Piroline  Schooner Australia 2 Spring Proctor/Prior-A//Proctor/Ci3576  Franklin Australia 2 Spring Shannon/Triumph  AC Legend Canada 6 Spring Chapais/CIMMYT-6  Harrington Canada 2 Spring Klages/3/Gazelle/Betzes//Centennial  Encore Canada 6 Spring Cadette/QB198.39  TR306 Canada 2 Spring Unknown  AC Metcalfe Canada 2 Spring Oxbow/Manley  CDC Copeland Canada 2 Spring TR118/WM861-5  CDC Kendall Canada 2 Spring Manley/SM85221  Viviane Canada 6 Spring Unknown  OAC Kippen Canada 6 Spring York//Ci10853/Parkland/3/Perth  AC Kings Canada 2 Spring AB79-17/Iona  Island Canada 2 Spring TBR635-25/Symko  Grant Canada 6 Spring P885-4/P854-35  Yangnongpi 4 China 2 Winter Sunong 91-7112/Tongying 1  Ci4196 China 2 Winter Unknown  Zhedar 1 China 2 Winter Unknown  ZJU 8 China 2 Winter Shang 89-0917/92-18  Supi 3 China 2 Winter Kinuyu Taka/Kanto Nijo 25//Hu 94-043  Daner China 2 Winter Naso Nijo/Sihuyu Taka  Kenpi 8 China 2 Spring 86-1/Gimpel//Hungary 92-25  Hua 30 China 2 Winter Xiu 82-164/Xiumai l  Zhepi 8 China 2 Winter Zhepi 2/93-125  Ganpi 4 China 2 Spring Fawawit/Ba-nong-86259  Ganpi 3 China 2 Spring S-3/Fawawit  Xiumai 3 China 2 Winter Xiu 82-164/Xiumai l  Esterel France 6 Winter 7761/Plaisant  Franka Germany 6 Winter Vogelsanger-Gold/Senta//Dura/Dea/3/Vogelsanger-Gold  Nudinka Germany 2 Spring Emir/Volla//Lbp-840-N/3/Goldthorpe/4/Dr. Baentsch-N  Triumph Germany 2 Spring Unknown  Amaji Nijo Japan 2 Winter Fuji Nijo/Seijo 17  Golden Promise UK 2 Spring (M)Maythorpe  Proctor UK 2 Spring Kenia/Plumage-Archer  Kym UK 2 Spring Georgie/Hanna  Excel USA 6 Spring Cree/Bonanza//Manker/Robust  Stander USA 6 Spring Excel//Robust/Bumper  Steptoe USA 6 Spring Washington-3564/Unitan Genotyping of SSR 2 DNA was extracted from the leaf tissues of three-week-old seedlings (a single seedling per genotype), based on a modified cetyltrimethylammonium bromide (CTAB) method described by Stein et al. ( 2001 2001 ). Thirty-five SSR markers, five from each of the seven linkage groups with known map locations, were selected and used in this study after searching the web site at http://www.genetics.org/cgi/content/full/156/4/1997/DC1 http://www.genetics.org/cgi/content/full/156/4/1997/DC1 . These SSR primer sets were developed and mapped by Ramsay et al. ( 2000 2000 ). Detailed information about primer sequences and allele sizes is shown in Table 2 2 . Barley SSR marker Chromosome Motif Primer sequence (5′→3′) Annealing temperature (°C) Expected product (bp) Bmac0032 5(1H) (AC) 7 T(CA) 15 (AT) 9 CCATCAAAGTCCGGCTAG;GTCGGGCCTCATACTGAC 65 215 HVBDG 5(1H) (CT) 6 GAGAGAGAAAGAGAATGGCAGG;AAAAAACTGCACCCAATCACTT 60 145 EBmac0501 5(1H) (AC) 13 ACTTAAGTGCCATGCAAAG;AGGGACAAAAATGGCTAAG 58 151 Bmag0347 5(1H) (CT) 28 CTGGGATTGGATCACTCTAA;AAAACAAGTACTGAAAATAGGAGA 55 107 HVADH1 5(1H) (TGC) 7 GAATTCTCATGAGGGATGCTTC;CAACTGAAACTCATGGCCAT 60 206 HVM36 2(2H) (GA) 13 TCCAGCCGACAATTTCTTG;AGTACTCCGACACCACGTCC 55 114 Bmac0216 2(2H) (AC) 5 GTACTATTCTTTGCTTGGGC;ATACACATGTGCAAAACCATA 55 190 EBmag0793 2(2H) (GT) 13 (AG) 36 ATATATCAGCTCGGTCTCTCA;AACATAGTAGAGGCGTAGGTG 55 177 Bmac0134 2(2H) (AC) 28 CCAACTGAGTCGATCTCG;CTTCGTTGCTTCTCTACCTT 55 148 HVBKASI 2(2H) (C) 10 (A) 11 ATTGGCGTGACCGATATTTATGTTCA;CAAAACTGCAGCTAAGCAGGGGAACA 60 197 Bmac0209 3(3H) (AC) 13 CTAGCAACTTCCCAACCGAC;ATGCCTGTGTGTGGACCAT 58 176 Bmag0006 3(3H) (AG) 17 TTAAACCCCCCCCCTCTAG;TGCAGTTACTATCGCTGATTTAGC 58 174 Bmag0508A 3(3H) (AG) 14 TCTCCGTATATTTAGGAAACG;TATCTCCCCCTAGATAGAAGG 55 175 Bmag0905 3(3H) (TC) 14 TTTATCTCCCCCTAGATAGAAG;TCTCCGTATATTTAGGAAACG 55 177 Bmag0853 3(3H) (GA) 15 ACAAGTATCCTGCAAACCTAA;CGACCTTCTTAATGGTTAGTG 55 183 HVM40 4(4H) (GA) 6 (GT) 4 (GA) 7 CGATTCCCCTTTTCCCAC;ATTCTCCGCCGTCCACTC 55 160 HVRCABG 4(4H) (GA) 6 TTTAAAAGAAAAGTGAATGGC;TAATGAAGAATGAGGAGAAGC 55 123 EBmac0679 4(4H) (AC) 22 ATTGGAGCGGATTAGGAT;CCCTATGTCATGTAGGAGATG 55 148 Bmag0375 4(4H) (AG) 19 CCCTAGCCTTCCTTGAAG;TTACTCAGCAATGGCACTAG 58 135 Bmac0577 4(4H) (AC) 12 TCATACAGAAGCCCACACAG;TGCATGTTCATTCTAGACAGG 53 146 HVACL1 7(5H) (AT) 7 TTTGGAATTATTCTGTGGGACC;GGGATTCAATCAAGTATTCGGA 60 150 HVDHN7 7(5H) (AAC) 5 TTAGGGCTACGGTTCAGATGTT;ACGTTGTTCTTCGCTGCTG 58 177 HVLEU 7(5H) (ATTT) 4 TTGGAAGTGTACAGCAATGGAG;TGAAAGGCCCCACAAGATAG 60 166 Bmac0306 7(5H) (AC) 10 -(AC) 5 CCTTGTGTGAGTGTGTGTG;ACATGCACATGAACTAATCAA 58 127 EBmatc0003 7(5H) (ATC) 4 N 3 (ATC) 3 AATTTTGCAAAGCTGGAGG;CATTATGGTGGGGTTCATGT 58 111 HVM34 6(6H) (GA) 10 ACCATGTTGCGTGTTGCTT;CGGTTCGAAATCGAGTGG 60 222 Bmac0127 6(6H) (AC) 26 AACTATGTCCAGTCGTTTCC;CTTGTCGTATCATCTTATTCAGA 58 118 Bmag0344 6(6H) (CT) 10 GT(CT) 16 GATCCAACTATATTAACAAAGCC;TGAGGGTATGTACCACTAGCT 60 165 Bmag0103 6(6H) (AG) 22 AAAATATTGGCATGAGCTTAG;ATCAAAGATCACATCCTTCC 55 166 Bmag0807 6(6H) (TC) 18 GGATATAAGGGTCCATAGCA;AATTACATCAAATAGGCTCCA 55 111 HVCMA 1(7H) (AT) 9 GCCTCGGTTTGGACATATAAAG;GTAAAGCAAATGTTGAGCAACG 60 141 HVWAXYG 1(7H) (AT) 9 TCCAATGGCATCTACAGGACGGCCAA;GCAGGTTGAGCTGCGCAAAGTCGTCG 58 205 Bmag0135 1(7H) (AG) 10 GG(AG) 12 ACGAAAGAGTTACAACGGATA;GTTTACCACAGATCTACAGGTG 58 161 Bmag0217 1(7H) (AG) 19 AATGCTCAAATATCTATCATGAA;GGGGCTGTCACAAGTATATAG 58 196 HVM04 1(7H) (AT) 9 AGAGCAACTACCAGTCCAATGGCA;GTCGAAGGAGAAGCGGCCCTGGTA 55 198 Polymerase chain reactions (PCRs) were performed in a MyCycler™ thermocycler (Bio-Rad Laboratories, USA). The volume of PCR solution was 15 μl, containing 75 ng of template DNA, 1× PCR buffer (Mg 2+ free), 0.375 U of Taq DNA polymerase, 300 μmol/L of deoxynucleotide triphosphates (dNTPs), 2.25 mmol/L of Mg 2+ , and 0.75 μmol/L of forward and reverse primers. The optimized PCR amplifying conditions used are available at http://www.genetics.org/cgi/content/full/156/4/1997/DC1 http://www.genetics.org/cgi/content/full/156/4/1997/DC1 (Ramsay et al., 2000 2000 ). The amplified fragments were separated on 6% (w/v) native polyacrylamide gels. The electrophoreses were performed at 90 W for 2 h in 1× TBE [Tris-borate-ethylenediaminetetraacetic acid (EDTA)] buffer, and the gels were visualized with the silver stain method as described by Bassam et al. ( 1991 1991 ). The sizes of all fragments were determined by comparing the most intense band with the NoLimits™ DNA sequence marker (Shanghai Sangon Biological Engineering Technology & Services Co., China). Data analysis 2 The number of alleles detected by each SSR marker was estimated for each genotype and all SSR marker loci were scored as described by Struss and Plieske ( 1998 1998 ). The resulting matrix was used to estimate genetic similarity (GS) among all varieties by Dice coefficient of similarity (Nei and Li, 1979 1979 ): GS=2 N ij /( N i + N j ), where N ij is the number of allele types presented in both genotypes i and j , N i is the number of allele types presented in genotype i , and N j is the number of allele types presented in genotype j . Based on the similarity matrix, a dendrogram showing the genetic relationships between genotypes was constructed by the unweighted pair group method with arithmetic average (UPGMA) using the software NTSYS-pc (numerical taxonomy and multivariate systems) Version 2.01 (Rohlf, 1998 1998 ). Results 1 Allelic variation of SSR markers 2 Using DNA samples isolated from 40 barley accessions as templates, polymorphic DNA fragments were amplified from 29 among the 35 SSR primer pairs selected in this study, including 3 out of 5 SSRs (60%) located on chromosome 2H, 4 out of 5 (80%) on chromosomes 1H, 4H, 5H, and 6H, and all (100%) on chromosomes 3H and 7H, respectively (Table 3 3 ). The sizes of these fragments ranged from 100 to 300 bp. A total of 85 alleles with the average alleles per locus of 2.4 were detected at 35 loci. More than one allele was detected at 29 out of all 35 SSRs studied, with the polymorphic markers’ ratio of 82.9% of polymorphic markers. The maximum of five alleles were observed at the loci of Bmac0134 on chromosome 2H and HVRCABG on chromosome 4H, respectively. 2 Chromosome 5 Number of SSRs 2 Total allele number 1 allele 2 alleles 3 alleles 4 alleles 5 alleles 1H 1 1 2 1 0 13 2H 2 2 0 0 1 11 3H 0 1 4 0 0 14 4H 1 1 2 0 1 14 5H 1 3 1 0 0 10 6H 1 3 0 1 0 11 7H 0 3 2 0 0 12 Genetic similarity (GS) 2 Significant genetic variation was found among all barley accessions with the GS value ranging from 0.39 to 0.98. The GS value was ranged from 0.45 to 0.88 within the group of Chinese developed varieties, and from 0.39 to 0.98 within the group of introduced varieties, indicating that there was a higher genetic diversity among introduced barley varieties. Cluster analysis 2 All 40 barley accessions were discriminated successfully by SSR markers (Fig. 1 1 ). The accessions were classified into two groups (Groups 1 and 2) at the level of GS=0.57. Group 1 included 6 accessions, while Group 2 consisted of 34 accessions. At the level of GS=0.62, Group 2 was further divided into two subgroups (Subgroups 2a and 2b) containing 11 and 23 accessions, respectively. Twelve Chinese malting barley varieties were clustered into different groups, two in Group 1, seven in Subgroup 2a and three in Subgroup 2b, respectively. All European barley varieties appeared in the same subgroup. Discussion 1 In this study, 85 alleles were detected with 35 SSR loci, and allelic variations existed at 29 SSR loci. The average allele number per locus, ranging from 1 to 5 alleles detected from 40 barley accessions for each individual locus, was 2.4. This relatively small number is probably due to the limited accessions and relatively high GS within the investigated group of barley germplasm. However, since the SSR loci selected were evenly distributed along the barley genome, the genetic relationships revealed by this study within the investigated group of barley varieties are representative and meaningful. Evaluation of the amount of genetic variation in barley germplasm is the essential study for barley breeding. Outcomes of the assessments provide a general guide for choosing parental lines to make suitable cross combinations for particular breeding purposes. The evaluation of genetic variation among barley resources from different countries has been reported (Russell et al., 1997 1997 ; Pejic et al., 1998 1998 ; Struss and Plieske, 1998 1998 ; Ivandic et al., 2002 2002 ; Matus and Hayes, 2002 2002 ; Feng et al., 2003 2003 ; Shi et al., 2004 2004 ; Hou et al., 2005 2005 ). As one of the genetic diversity centers of barley, China is rich in both landrace and cultivated barley (Feng et al., 2003 2003 ). Several studies were conducted in China to evaluate the genetic relationships among different barley populations (Feng et al., 2003 2003 ; Shi et al., 2004 2004 ; Hou et al., 2005 2005 ). Pejic et al. ( 1998 1998 ) reported that the information of polymorphism would be sufficient if more than 70 alleles were detected. Shi et al. ( 2004 2004 ) suggested that more than two SSRs from each of seven linkage groups should be selected to ensure the efficiency and representation of the genetic information among accessions. Saghai Maroof et al. ( 1994 1994 ) reported that 71 alleles were detected in the 207 samples of wild and cultivated barley with four SSR primer pairs. The largest number of alleles found at locus HVM4 was 37. Other researchers have shown smaller numbers of alleles per locus in barley accessions, with a range of 1 to 16 (Becker and Heun, 1995 1995 ; Struss and Plieske, 1998 1998 ; Davila et al., 1999 1999 ; Matus and Hayes, 2002 2002 ; Feng et al., 2003 2003 ). Evaluation of the extent and the nature of genetic variation in barley germplasm provides valuable information for the conservation of germplasm. Genetic relationships were found to be very close among the Chinese malting barley varieties analyzed in this study. The fact that seven malting barley varieties developed in China were clustered into the same subgroup gave the strong indications of the narrow genetic background in Chinese malting barley germplasm. The introduced foreign genotypes investigated in this study, on the other hand, showed a broader genetic diversity. To avoid the potential risks associated with too little genetic diversity, the adoption of elite genotypes from different origins used as parental lines is highly recommended for malting barley breeding in China. Barley breeding organizations should stress the necessity for the collection, conservation, and utilization of the cultivated varieties and the landraces. Matus and Hayes ( 2002 2002 ) found that germplasm classifications generally coincided with geographic origin and end-use quality. Pillen et al. ( 2002 2002 ) also found that German barley varieties could be easily classified by SSR markers. On the other hand, Plaschke et al. ( 1995 1995 ) and Russell et al. ( 1997 1997 ) suggested that SSR markers could not differentiate genetic resources of related pedigrees. Our results demonstrate that the data generated from a set of 35 SSR markers were highly informative. The 40 varieties were distinguished successfully. Three Chinese spring varieties were clustered into Subgroup 2b with almost all spring barley varieties from other sources. Seven Chinese winter varieties were clustered into Subgroup 2a. Another two Chinese winter varieties ‘Zhedar 1’ and ‘Ci4196’ were classified into Group 1 with four North America (including USA and Canadian) varieties. It is interesting to note that the varieties in the same group always share one or more common breeding ancestors according to pedigree information. For example, the Chinese varieties ‘Ganpi 3’, ‘Ganpi 4’, and ‘Kenpi 8’ were present in Subgroup 2b. This group included many European varieties. Hungarian barley resources have been used as the parental lines over the time to develop these varieties (Wang et al., 2003 2003 ; Li et al., 2006 2006 ). Similar cases could be found in Group 1, in which two Chinese varieties ‘Zhedar 1’ and ‘Ci4196’ were adopted by the Canadian and American researchers in the 1990’s (Evans et al., 2000 2000 ; Urrea et al., 2002 2002 ). It was reported that the SSR marker EBmac0501 on chromosome 1H was associated with malt extract (Zale et al., 2000 2000 ; Hoffman and Dahleen, 2002 2002 ; Emebiri et al., 2004 2004 ; Panozzo et al., 2007 2007 ). In our study, the results generated from genotyping of EBmac0501 indicated that eight malting barley varieties ‘Yangnongpi 4’, ‘Amaji Nijo’, ‘Daner’, ‘ZJU 8’, ‘Supi 3’, ‘Zhepi 8’, ‘Hua 30’, and ‘Xiumai 3’ showed the same allele. Thus, it appears that the SSR marker EBmac0501 is also very likely to be associated with malt extract in Chinese malting barley. However, further validation is needed to confirm the candidate regions of key QTL for the characteristics of malting quality in Chinese barley. References MJ Asins , EA Carbonell . Distribution of genetic variability in a durum wheat world collection . Theor Appl Genet , 1989 . 77 ( 2 ): 287 - 294 . DOI: 10.1007/BF00266199 http://doi.org/10.1007/BF00266199 . Distribution of genetic variability in a durum wheat world collection BJ Bassam , G Caetano-Anollés , PM Gresshoffet . Fast and sensitive silver staining of DNA in polyacrylamide gels . Anal Biochem , 1991 . 196 ( 1 ): 80 - 83 . 1716076 DOI: 10.1016/0003-2697(91)90120-I http://doi.org/10.1016/0003-2697(91)90120-I . Fast and sensitive silver staining of DNA in polyacrylamide gels J Becker , M Heun . Barley microsatellites: alleles variation and mapping . Plant Mol Biol , 1995 . 27 ( 4 ): 835 - 845 . 7727762 DOI: 10.1007/BF00020238 http://doi.org/10.1007/BF00020238 . Barley microsatellites: alleles variation and mapping AHD Brown , JJ Burdon , JP Grace . Genetic structure of Glycine canescens : a perennial relative of soybean . Theor Appl Genet , 1990 . 79 ( 6 ): 729 - 736 . DOI: 10.1007/BF00224237 http://doi.org/10.1007/BF00224237 . Genetic structure of Glycine canescens: a perennial relative of soybean JA Davila , Y Loarce , L Ramsay , R Waugh , E Ferrer . Comparison of RAMP and SSR markers for the study of wild barley genetic diversity . Hereditas , 1999 . 131 ( 1 ): 5 - 13 . 10628292 DOI: 10.1111/j.1601-5223.1999.00005.x http://doi.org/10.1111/j.1601-5223.1999.00005.x . Comparison of RAMP and SSR markers for the study of wild barley genetic diversity LC Emebiri , DB Moody , JF Panozzo , BJ Read . Mapping of QTL for malting quality attributes in barley based on a cross of parents with low grain protein concentration . Field Crops Res , 2004 . 87 ( 2-3 ): 195 - 205 . DOI: 10.1016/j.fcr.2003.11.002 http://doi.org/10.1016/j.fcr.2003.11.002 . Mapping of QTL for malting quality attributes in barley based on a cross of parents with low grain protein concentration CK Evans , W Xie , R Dill-Macky , CJ Mirocha . Biosynthesis of deoxynivalenol in spikelets of barley inoculated with macroconidia of Fusarium graminearum . Plant Dis , 2000 . 84 ( 6 ): 654 - 660 . DOI: 10.1094/PDIS.2000.84.6.654 http://doi.org/10.1094/PDIS.2000.84.6.654 . Biosynthesis of deoxynivalenol in spikelets of barley inoculated with macroconidia of Fusarium graminearum FAO Draft Second Report on the State of the World’s Plant Genetic Resources for Food and Agriculture , 2009 . Available from: ftp://ftp.fao.org/docrep/fao/meeting/017/ak528e.pdf ftp://ftp.fao.org/docrep/fao/meeting/017/ak528e.pdf [Accessed on Apr. 5, 2010] . Draft Second Report on the State of the World’s Plant Genetic Resources for Food and Agriculture ZY Feng , YZ Zhang , LL Zhang , HQ Ling . Genetic diversity and geographical differentiation of Hordeum vulgare ssp. spontaneum in Tibet using microsatellite markers . High Tech Lett , 2003 . 13 ( 10 ): 46 - 53 . (in Chinese) . Genetic diversity and geographical differentiation of Hordeum vulgare ssp. spontaneum in Tibet using microsatellite markers D Hoffman , L Dahleen . Markers polymorphic among malting barley ( Hordeum vulgare L.) cultivars of a narrow gene pool associated with key QTLs . Theor Appl Genet , 2002 . 105 ( 4 ): 544 - 554 . 12582503 DOI: 10.1007/s00122-002-0954-9 http://doi.org/10.1007/s00122-002-0954-9 . Markers polymorphic among malting barley (Hordeum vulgare L.) cultivars of a narrow gene pool associated with key QTLs RD Horsley , PB Schwarz , JJ Hammond . Genetic diversity in malt quality of North American six-rowed spring barley germplasm . Crop Sci , 1995 . 35 ( 1 ): 113 - 118 . DOI: 10.2135/cropsci1995.0011183X003500010021x http://doi.org/10.2135/cropsci1995.0011183X003500010021x . Genetic diversity in malt quality of North American six-rowed spring barley germplasm YC Hou , ZH Yan , XJ Lan , YM Wei , YL Zheng . Genetic diversity among barley germplasm with known origins based on the RAMP and ISSR markers . Sci Agric Sin , 2005 . 38 ( 12 ): 2555 - 2565 . (in Chinese) . Genetic diversity among barley germplasm with known origins based on the RAMP and ISSR markers V Ivandic , CA Hackett , E Nevo , R Keith , WTB Thomas , BP Forster . Analysis of simple sequence repeats (SSRs) in wild barley from the Fertile Crecent: associations with ecology, geography and flowering time . Plant Mol Biol , 2002 . 48 ( 5-6 ): 511 - 527 . 11999832 DOI: 10.1023/A:1014875800036 http://doi.org/10.1023/A:1014875800036 . Analysis of simple sequence repeats (SSRs) in wild barley from the Fertile Crecent: associations with ecology, geography and flowering time JZ Li , TG Sjakste , MS Röder , MW Ganal . Development and genetic mapping of 127 new microsatellite markers in barley . Theor Appl Genet , 2003 . 107 ( 6 ): 1021 - 1027 . 12879255 DOI: 10.1007/s00122-003-1345-6 http://doi.org/10.1007/s00122-003-1345-6 . Development and genetic mapping of 127 new microsatellite markers in barley ZA Li , WZ Xu , J Li , CX Liang , AH Dang , J Zhou . New malting barley variety ‘Kenpi 8’ . Barley Cereal Sci , 2006 . 86 31 - 32 . (in Chinese) . New malting barley variety ‘Kenpi 8’ ZW Liu , RM Biyashev , MA Saghai Maroof . Development of simple sequence repeat DNA markers and their integration into a barley linkage map . Theor Appl Genet , 1996 . 93 ( 5-6 ): 869 - 876 . DOI: 10.1007/BF00224088 http://doi.org/10.1007/BF00224088 . Development of simple sequence repeat DNA markers and their integration into a barley linkage map TC Marcel , RK Varshney , M Barbieri , H Jafary , MJD de Kock , A Graner , RE Niks . A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues . Theor Appl Genet , 2007 . 114 ( 3 ): 487 - 500 . 17115126 DOI: 10.1007/s00122-006-0448-2 http://doi.org/10.1007/s00122-006-0448-2 . A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues IA Matus , PM Hayes . Genetic diversity in three groups of barley germplasm assessed by simple sequence repeats . Genome , 2002 . 45 ( 6 ): 1095 - 1106 . 12502254 DOI: 10.1139/g02-071 http://doi.org/10.1139/g02-071 . Genetic diversity in three groups of barley germplasm assessed by simple sequence repeats M Nei , WH Li . Mathematical model for studying genetic variation in terms of restriction endonucleases . PNAS , 1979 . 76 ( 10 ): 5269 - 5273 . 291943 DOI: 10.1073/pnas.76.10.5269 http://doi.org/10.1073/pnas.76.10.5269 . Mathematical model for studying genetic variation in terms of restriction endonucleases JF Panozzo , PJ Eckermann , DE Mather , DB Moody , CK Black , HM Collins , AR Barr , P Lim , BR Cullis . QTL analysis of malting quality traits in two barley populations . Aust J Agric Res , 2007 . 58 ( 9 ): 858 - 866 . DOI: 10.1071/AR06203 http://doi.org/10.1071/AR06203 . QTL analysis of malting quality traits in two barley populations I Pejic , P Ajmone-Marsan , M Morgante , V Kozumplick , P Castiglioni , G Taramino , M Motto . Comparative analysis of genetic similarity among maize inbred lines detected by RFLPs, RAPDs, SSRs and AFLPs . Theor Appl Genet , 1998 . 97 ( 8 ): 1248 - 1255 . DOI: 10.1007/s001220051017 http://doi.org/10.1007/s001220051017 . Comparative analysis of genetic similarity among maize inbred lines detected by RFLPs, RAPDs, SSRs and AFLPs K Pillen , A Binder , B Kreuzkam , L Ramsay , R Waugh , J Förster , J Léon . Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars . Theor Appl Genet , 2002 . 101 ( 4 ): 652 - 660 . DOI: 10.1007/s001220051527 http://doi.org/10.1007/s001220051527 . Mapping new EMBL-derived barley microsatellites and their use in differentiating German barley cultivars J Plaschke , MW Ganal , MS Röder . Detection of genetic diversity in closely related bread wheat using microsatellite markers . Theor Appl Genet , 1995 . 91 ( 6-7 ): 1001 - 1007 . DOI: 10.1007/BF00223912 http://doi.org/10.1007/BF00223912 . Detection of genetic diversity in closely related bread wheat using microsatellite markers KG Pushpendra , SB Harindra , LK Pawan , K Neeraj , K Ajay , RM Reyazul , M Amita , K Jitendra . QTL analysis for some quantitative traits in bread wheat . J Zhejiang Univ-Sci B , 2007 . 8 ( 11 ): 807 - 814 . 17973342 DOI: 10.1631/jzus.2007.B0807 http://doi.org/10.1631/jzus.2007.B0807 . QTL analysis for some quantitative traits in bread wheat L Ramsay , M Macaulay , SD Ivanissevich , K Maclean , L Cardle , J Fuller , KJ Edwards , S Tuvesson , M Morgante , A Massari , 等 . A simple sequence repeat-based linkage map of barley . Genetics , 2000 . 156 ( 4 ): 1997 - 2005 . 11102390 . A simple sequence repeat-based linkage map of barley DC Rasmusson , RL Phillips . Plant breeding progress and genetic diversity from de novo variation and elevated epistasis . Crop Sci , 1997 . 37 ( 2 ): 303 - 310 . DOI: 10.2135/cropsci1997.0011183X003700020001x http://doi.org/10.2135/cropsci1997.0011183X003700020001x . Plant breeding progress and genetic diversity from de novo variation and elevated epistasis CS Reddy , AP Babu , BPM Swamy , K Kaladhar , N Sarla . ISSR markers based on GA and AG repeats reveal genetic relationship among rice varieties tolerant to drought, flood, or salinity . J Zhejiang Univ-Sci B , 2009 . 10 ( 2 ): 133 - 141 . 19235272 DOI: 10.1631/jzus.B0820183 http://doi.org/10.1631/jzus.B0820183 . ISSR markers based on GA and AG repeats reveal genetic relationship among rice varieties tolerant to drought, flood, or salinity FJ Rohlf . NTSYS-pc: Numerical Taxonomy and Multivariate Analysis System , 1998 . Version 2.01 : Setauket, New York, USA Exeter Software , . NTSYS-pc: Numerical Taxonomy and Multivariate Analysis System JR Russell , J Fuller , G Young , B Thomas , G Taramino , M Macaulay , R Waugh , W Powell . Discriminating between barley genotypes using microsatellite markers . Genome , 1997 . 40 ( 4 ): 442 - 450 . 9276933 DOI: 10.1139/g97-059 http://doi.org/10.1139/g97-059 . Discriminating between barley genotypes using microsatellite markers MA Saghai Maroof , RM Biyashev , GP Yang , Q Zhang , RW Allard . Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations and population dynamics . PNAS , 1994 . 91 ( 12 ): 5466 - 5470 . 8202509 DOI: 10.1073/pnas.91.12.5466 http://doi.org/10.1073/pnas.91.12.5466 . Extraordinarily polymorphic microsatellite DNA in barley: species diversity, chromosomal locations and population dynamics YT Shi , HW Bian , N Han , JW Pan , WX Tong , MY Zhu . Genetic Variation Analysis by RAPD of Some Barley Cultivars in China . Acta Agron Sin , 2004 . 30 ( 3 ): 258 - 265 . (in Chinese) . Genetic Variation Analysis by RAPD of Some Barley Cultivars in China N Stein , G Herren , B Keller . A new DNA extraction method for high-throughput marker analysis in a large-genome species such as Triticum aestivum . Plant Breed , 2001 . 120 ( 4 ): 354 - 356 . DOI: 10.1046/j.1439-0523.2001.00615.x http://doi.org/10.1046/j.1439-0523.2001.00615.x . A new DNA extraction method for high-throughput marker analysis in a large-genome species such as Triticum aestivum D Struss , J Plieske . The use of microsatellite markers for detection of genetic diversity in barley populations . Theor Appl Genet , 1998 . 97 ( 1-2 ): 308 - 315 . DOI: 10.1007/s001220050900 http://doi.org/10.1007/s001220050900 . The use of microsatellite markers for detection of genetic diversity in barley populations CA Urrea , RD Horsley , BJ Steffenson , PB Schwarz . Heritability of Fusarium head blight resistance and deoxynivalenol accumulation from barley accession CIho 4196 . Crop Sci , 2002 . 42 ( 5 ): 1404 - 1408 . DOI: 10.2135/cropsci2002.1404 http://doi.org/10.2135/cropsci2002.1404 . Heritability of Fusarium head blight resistance and deoxynivalenol accumulation from barley accession CIho 4196 RK Varshney , TC Marcel , L Ramsay , J Russell , MS Röder , N Stein , R Waugh , P Langridge , RE Nike , A Graner . A high density barley microsatellite consensus map with 775 SSR loci . Theor Appl Genet , 2007 . 114 ( 6 ): 1091 - 1103 . 17345060 DOI: 10.1007/s00122-007-0503-7 http://doi.org/10.1007/s00122-007-0503-7 . A high density barley microsatellite consensus map with 775 SSR loci XZ Wang , YD Pan , F Chen . Breeding of a new malting barley variety Ganpi 4 . Gansu Agric Sci Technol , 2003 . 3 8 - 10 . (in Chinese) . Breeding of a new malting barley variety Ganpi 4 JM Zale , JA Clancy , SE Ullrich , BL Jones , PM Hayes . Summary of barley malting quality QTL mapped in various populations . Barley Genet Newslett , 2000 . 30 44 - 54 . . Summary of barley malting quality QTL mapped in various populations We sincerely thank Dr. Alek CHOO (Eastern Cereal and Oilseed Research Centre, Agriculture and Agri-Food Canada) for providing valuable barley varieties for this study. 10.1631/jzus.B0900414 Project supported by the National Natural Science Foundation of China (Nos. 30700485 and 30771333), and the Zhejiang Provincial Natural Science Foundation (No. Y306641), China 2009-12-27 2010-09-01 2010-04-16 2022-01-05 Copyright © Zhejiang University and Springer-Verlag Berlin Heidelberg 2010 2010 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 10 11