Abundance and composition of ammonia-oxidizing bacteria and archaea in different types of soil in the Yangtze River estuary

Abundance and composition of ammonia-oxidizing bacteria and archaea in different types of soil in the Yangtze River estuary 1 3 first-author 1 2 2 1 1 corresp ‡Corresponding Author ‡Corresponding Author †E-mail:quanzx@fudan.edu.cn †E-mail:quanzx@fudan.edu.cn quanzx@fudan.edu.cn Department of Microbiology and Microbial Engineering, School of Life Sciences, Fudan University, Shanghai 200433, China Department of Microbiology and Microbial Engineering, School of Life Sciences, Fudan University, Shanghai 200433, China Ministry of Education Key Laboratory for Biodiversity Science and Ecological Engineering, School of Life Sciences, Fudan University, Shanghai 200433, China Ministry of Education Key Laboratory for Biodiversity Science and Ecological Engineering, School of Life Sciences, Fudan University, Shanghai 200433, China Laboratory of Applied Microbiology, Faculty of Life Science and Technology, Kunming University of Science and Technology, Kunming 650224, China Laboratory of Applied Microbiology, Faculty of Life Science and Technology, Kunming University of Science and Technology, Kunming 650224, China Tidal flats are soil resources of great significance. Nitrification plays a central role in the nitrogen cycle and is often a critical first step in nitrogen removal from estuarine and coastal environments. We determined the abundance as well as composition of ammonia-oxidizing bacteria (AOB) and ammonia-oxidizing archaea (AOA) in different soils during land reclamation process. The abundance of AOA was higher than that of AOB in farm land and wild land while AOA was not detected in tidal flats using real-time polymerase chain reaction (PCR). The different abundances of AOB and AOA were negatively correlated with the salinity. The diversities of AOB and AOA were also investigated using clone libraries by amplification of amoA gene. Among AOB, nearly all sequences belonged to the Nitrosomonas lineage in the initial land reclamation process, i.e., tidal flats, while both Nitrosomonas and Nitrosospira lineages were detected in later and transition phases of land reclamation process, farm land and wild land. The ratio of the numbers of sequences of Nitrosomonas and Nitrosospira lineages was positively correlated with the salinity and the net nitrification rate. As for AOA, there was no obvious correlation with the changes in the physicochemical properties of the soil. This study suggests that AOB may be more import than AOA with respect to influencing the different land reclamation process stages. Wetland Nitrification Ammonia-oxidizing microorganisms Abundance Composition Introduction 1 Nitrification is the microbial oxidation of ammonia to nitrate via nitrite, which links the mineralization of organic matter-derived nitrogen to its ultimate removal as gaseous products by denitrification or anaerobic ammonia oxidization in estuarine and continental shelf sediments (Bernhard et al., 2007 2007 ). Ammonia oxidation, the first and rate-limiting step in the nitrification process, is an important component of the nitrogen cycle. Aerobic lithotrophic nitrifiers comprise bacterial and archaeal ammonia oxidizers (Rotthauwe et al., 1997 1997 ; Francis et al., 2005 2005 ; Zhang et al., 2010 2010 ). Autotrophic ammonia-oxidizing bacteria (AOB) are affiliated with the β-Proteobacteria including genera Nitrosomonas and Nitrosospira (Head et al., 1993 1993 ; Purkhold et al., 2000 2000 ; 2003 2003 ) and the γ-Proteobacteria including genus Nitrosococcus (Ward and O′Mullan, 2002 2002 ). Environmental studies have focused primarily on the β-Proteobacteria because of their relative abundance in many environments especially in soils and sediments (Jia and Conrad, 2009 2009 ; Wells et al., 2009 2009 ). Recently, archaea that oxidize ammonia have been discovered (Venter et al., 2004 2004 ; Könneke et al., 2005 2005 ; Treusch et al., 2005 2005 ) and several studies revealed that ammonia-oxidizing archaea (AOA), which belong to a novel phylum Thaumarchaeota (Brochier-Armanet et al., 2008 2008 ; Spang et al., 2010 2010 ), are the predominant ammonia oxidizers in various soil environments (Leininger et al., 2006 2006 ; Zhang et al., 2010 2010 ). Given its functional significance and conserved phylogeny, the ammonia monooxygenase ( amoA ) gene (Sharp et al., 1984 1984 ), which catalyzes the first step of ammonia oxidation, has been used as a molecular marker to study both the diversities and abundances of AOB and AOA in marine and terrestrial environments, such as water columns (Santoro et al., 2008 2008 ), sediments (Moin et al., 2009 2009 ), activated sludge (Wells et al., 2009 2009 ), and soils (Di et al., 2010 2010 ). These new findings have stimulated reassessment of the ecological importance of these groups (AOB and AOA) in agricultural ecosystems. China faces severe problems in terms of inadequate resources and environment contamination as the result of population growth and reduction in the amount of arable land. Wetlands, especially in coastal estuaries and muddy tidal flats, have a large potential for use as land resources. Reclamation of tidal flats into arable land is of great significance because it helps to alleviate the problem of limited soil resources. The estuary of the Yangtze River is the largest in China (Li et al., 2010 2010 ). The Dongtan Wetland is an intertidal estuarine wetland that is located at the eastern end of Chongming Island in the Yangtze River estuary. Chongming Island is the third largest island in China and the largest alluvial island in the world (Gan et al., 2009 2009 ). The precursor of the present Chongming Island was a small inter-tidal shoal, and it has doubled in size over the last 50 years to about 120×10 3 ha, and is still growing by more than 200 ha per year through the increase of alluvial and land reclamation in tidal flats (Li et al., 2010 2010 ). Land reclamation in tidal flats is a common practice globally. The agricultural soil present on Chongming Island increased by 729 ha per year via land reclamation in the past 20 years (Gao and Zhao, 2006 2006 ). Sea dikes can be used to drain the salt marshes of tidal wetlands to create wild land. Tidal flats, wild land, and farm land are three typical stages of the soil utilization process. A recent study pointed out that the primary controller of the distribution of soil bacteria was soil habitat characteristics (Fierer and Jackson, 2006 2006 ). Soil types were considered to be the primary factor influencing bacterial composition and abundance (Girvan et al., 2003 2003 ). A number of studies have shown that the community structures of AOA and AOB change in response to fertilizer management (Enwall et al., 2005 2005 ; He et al., 2007 2007 ). The composition and abundance of ammonia oxidizers could be used as one important biological indicator in monitoring soil quality for agriculture (Bastida et al., 2008 2008 ). Therefore, the analysis of correlations between the ammonia oxidizers and soil characteristics may provide useful information in guiding efficient use of emerging land resources formed by the Yangtze River. In this study, we examined the ecology of ammonia-oxidizing microbial communities in soils in the Dongtan Wetland of Chongming Island by examining the diversity and abundance of the amoA gene for both AOB and AOA in three types of soils (tidal flats, wild land, and farm land). The abundances of AOB and AOA were quantified with real-time polymerase chain reaction (PCR) techniques, and the community compositions of the AOB and AOA were analyzed using amoA gene clone libraries. The effects of the soil physicochemical properties on the AOB and AOA communities were determined using statistical analysis. Materials and methods 1 Experimental sites and sampling 2 Three different sites were selected as study sites in the Dongtan Wetland of Chongming Island, Shanghai, China. The coordinates of each site were as follows: tidal flat (T) (31°30′ N, 121°58′ E), wild land (W) (31°30′ N, 121°57′ E), and farm land (F) (31°31′ N, 121°51′ E). The coordinates were determined using the Global Positioning System (Explorist 110, Magellan). These sites represent a typical process in soil development in the Yangtze River estuary. The tidal flat was characterized by high primary production rates, and a consequent intense remineralization in the sediment without any interruption from activities of human beings. The wild land was the land at the other side of the dike and had been left unused after the sea dike construction for six years after a period of reclamation. The farm land has been a part of a long-term reclamation program since 1980 with a wheat-rape rotation system. Each site was sampled in March 2007 at a depth of 0–10 cm. Six soil cores (approximately 5 cm diameter) were taken from each site and the distance between two cores was 2 m. Each sample was placed in a sterile plastic bag and transported to the laboratory. All samples were stored at 4 °C for analysis of soil characteristics, and subsamples were stored at −20 °C for DNA extraction. Physicochemical analysis 2 Six soil cores were taken from each site and the physicochemical analyses of the six cores were measured separately. Soil pH was determined using a HANNA HI 9025 pH meter (Hanna, Italy). Water content and salinity were determined using a WET sensor (Delta-T, UK). Soil bulk density was determined by oven-drying a fixed volume of each soil core at 105 °C to constant weight. Total carbon (TC) and total nitrogen (TN) were analyzed using a FLASH EA 1112 series, CHNSO analyzer (Thermo, Italy). Ammonium and nitrate levels were determined by indophenol blue colorimetry (Solorzano, 1969 1969 ) and ultraviolet spectrophotometry (Norman and Stucki, 1981 1981 ), respectively. The soil net nitrification rate was determined as previously described (Fernandez et al., 2000 2000 ; Kelly et al., 2011 2011 ). To measure the net nitrification rate, 50 g of fresh soil was added to each bottle and bottles were covered loosely. Water was added every 2 or 3 d to maintain constant water content and aerobic conditions. The ammonia and nitrate concentrations were determined again after soil samples were incubated at 25 °C for 20 d. The net nitrification rate was equal to the average difference between the nitrate concentrations before and after incubation. DNA extraction and preparation 2 Four gram of a composite soil sample for six cores of each site was used to DNA extraction according to the procedure described by Zhou et al. ( 1996 1996 ). Deoxyribonucleic acid was purified using the Wizard DNA Clean-Up system (Promega, USA) according to the manufacturer’s protocol. The concentration of extracted DNA was determined using a NanoDrop 1000 UV-Vis spectrophotometer (Thermo Fisher, USA). Construction of amoA gene clone libraries of AOB and AOA 2 The amoA gene was amplified with the primer pair amoA -1F and amoA -2R (Rotthauwe et al., 1997 1997 ). The archaeal amoA gene was amplified with the primer pair Arch-amoAF and Arch-amoAR (Francis et al., 2005 2005 ). In all PCR amplifications, reactions were performed with Taq DNA MasterMix (Tiangen, China) with a total volume of 50 μl and 10 ng DNA added as the template. The PCR product was gel-purified with the QIAquick Gel Extraction Kit (Qiagen, USA) according to the manufacturer’s instructions and then ligated into the pMD-18 vector (TaKaRa, Japan). The resulting ligation products were used to transform Escherichia coli TG1 competent cells following the instructions of the manufacturer. Clones were randomly selected for sequencing using the primer M13F (5′-CTG GTA TCG GAT CGG CTG-3′). Richness, phylogenetic, and statistical analyses 2 Sequences were compared with those in GenBank (National Center of Biotechnology Information, NCBI). Nucleotide sequences were assembled and edited using BioEdit (Hall, 1999 1999 ), and nucleotide and amino acid sequence alignments were generated using ClustalX v1.83 (Jeanmougin et al., 1998 1998 ). Operational taxonomic units (OTUs) were defined as amino acid sequence groups in which sequences differed by ≤5%. The richness was determined using the Chao1 estimator by Mothur v.1.21.1 (Schloss et al., 2009 2009 ). The estimated coverage of the constructed amoA gene sequences was calculated as C =[1−( n 1 / N )]×100%, where n 1 is the number of singletons sequences, and N is the total number of sequences (Good, 1953 1953 ). Neighbor-joining phylogenetic trees (based on Jukes-Cantor distances) were constructed based on alignments of amino acid sequences using MEGA4.0 (Kumar et al., 2004 2004 ). Distance-based bootstrap analyses were conducted using MEGA4.0 and were used to estimate the reliability of phylogenetic reconstructions by running 1 000 replicates. The Pearson’s correlation coefficients describing the relationship between AOB or AOA abundance and soil physicochemical properties were calculated using SigmaPlot Version 11. The Pearson’s correlation coefficients for the relationships between the proportion changes of the sequences of the major lineages of AOB ( Nitrosospira lineage and Nitrosomonas lineage) or AOA (soil/sediment lineage and water column/sediment lineage) and soil physicochemical properties were also calculated. Analysis of similarities (ANOSIM) was performed to evaluate the similarities between each of the two clone libraries using Mothur v.1.21.1 (Schloss et al., 2009 2009 ). The correspondence analysis (CA) among the proportion changes of the sequences of the major lineages of AOB and AOA versus soil physicochemical properties was performed using MVSP Version 3.1. Real-time PCR assay 2 The clones containing the bacterial and archaeal amoA gene sequences confirmed by sequencing were cultured using Lysogeny Broth (LB) liquid medium with ampicillin. Plasmid DNA was extracted with an Axygen plasmid purification kit (Axygen, USA) and quantified using a NanoDrop 1000 UV-Vis spectrophotometer. The copy numbers of the amoA genes were calculated directly from the concentration of the extracted plasmid DNA, which was subjected to a real-time PCR assay in triplicate to generate an external standard curve. Real-time PCR was performed on an Mx3000P real-time PCR system (Stratagene, USA). Primers and TaqMan probes are listed in Table 1 1 . A total of 10 ng of each DNA extract was used as the template in each reaction mixture. Bacterial amoA genes were quantified using the primer pair amoA -1F/ amoA -2R (Rotthauwe et al., 1997 1997 ) with SYBR® Premix Ex Taq™ (TaKaRa, Japan). The primer pair Arch amo196F/Arch amo277R and the probe TM amo247F (Treusch et al., 2005 2005 ) were used for quantification of the archaeal amoA gene with real-time PCR master mix (Toyobo, Japan). The efficiency and coefficient ( r 2 ) of the real-time PCR, for the amplification of amoA gene from AOA and AOB, were 102% and 108%, 0.997 and 0.989, respectively. Real-time PCR was conducted using the protocol for each target group as shown in Table 1 1 . For the bacterial amoA gene assay, a melting curve analysis was performed to confirm PCR product specificity after the temperature increased from 55 °C to 95 °C following the three temperature steps. Target Primer or probe Name Sequence (5′ to 3′) Amplicon length (bp) Reference 2 Ammonia-oxidizing bacteria (AOB) Primer amoA -1F GGGGTTTCTACTGGTGGT 491 Rotthauwe et al., 1997 1997 Primer amoA -2R CCCCTCKGSAAAGCCTTCTTC 2 Ammonia-oxidizing archaea (AOA) Primer Arch amo196F GGWGTKCCRGGRACWGCMAC 123 Treusch et al., 2005 2005 Primer Arch amo277R CRATGAAGTCRTAHGGRTADCC Probe TM amo247F CAAACCAWGCWCCYTTKGCDACCCA Primer Arch-amoAF STAATGGTCTGGCTTAGACG 635 Francis et al., 2005 2005 Primer Arch-amoAR GCGGCCATCCATCTGTATGT Sequence accession numbers 2 The sequences obtained in this study have been deposited in the GenBank database under the accession Nos. HQ888765–HQ888800 (bacterial amoA gene sequences and deduced amino acid sequences of amoA gene) and HQ888801–HQ888822 (archaeal amoA gene sequences and deduced amino acid sequences of amoA gene). Results 1 Soil physicochemical properties 2 Significant differences ( P < 0.05) in the soil physicochemical properties of the three environments were observed (Table 2 2 ). Tidal flats had the highest pH (8.90±0.04) and salinity ((1.35±0.26)%). The lowest pH (7.51±0.25) and salinity ((0.09±0.01)%) were recorded in farm land. Farm land that received organic fertilizer treatment had the highest TC and TN levels. The NH 4 + -N level in tidal flats was higher than that in farm land, while the converse was true for NO 3 − -N Values are expressed as mean±SD ( n =6). Values within the same line followed by the same letter do not differ significantly ( P > 0.05) Parameter Tidal flats Wild land Farm land pH 8.90±0.04 a 8.39±0.19 b 7.51±0.25 c Density (g/cm 3 ) 1.49±0.09 a 1.76±0.05 b 1.47±0.14 a Salinity (%) 1.35±0.26 a 0.15±0.06 b 0.09±0.01 b Water content (%) 46.25±4.29 a 41.66±1.41 b 30.18±1.98 c TC (g/kg) 13.22±0.73 a 15.02±1.53 b 20.02±0.39 c TN (g/kg) 0.43±0.06 a 0.75±0.16 b 1.35±0.09 c C/N ratio 31.09±4.80 a 20.34±2.37 b 14.83±0.69 c NH 4 + -N (mg/kg) 9.47±1.11 a 7.91±2.16 a 4.82±0.73 b NO 3 − -N (mg/kg) 10.38±0.47 a 9.76±0.68 a 20.18±2.64 b Net nitrification rate (mg/(kg·d) 0.18±0.16 a 0.77±0.18 b 0.67±0.21 b The net nitrification rates were distinctly different between the primary soil and agricultural soil. The lowest nitrification rate was recorded in tidal flats. Quantification of ammonia-oxidizing microorganisms 2 The abundances of AOB and AOA were determined using a real-time PCR assay targeting the amoA gene. The smallest AOB community size was detected in the tidal flats, followed by the farm land and wild land; the content of AOB in the wild land and farm land was about 100 times higher than that of the tidal flats (Fig. 1 1 ). No significant differences were observed between the abundances in farm land and wild land ( P =0.56). Similar to AOB, the AOA population sizes were high in the farm land and wild land. However, AOA were not detected in the tidal flats by real-time PCR. There was no significant difference in the population size between farm land and wild land (both mean log 10 ratio AOA:AOB, 1.29) ( P =0.45). The amoA gene of AOA in tidal flats site was not detected. The columns with same letter are not significantly different from each other ( P > 0.05, n =3). The lower case letters showed significant differences in abundances of AOB and capital letters showed those in AOA Bacterial and archaeal amoA -based community structures 2 Both AOB and AOA partial amoA genes were sequenced in the three sites. A total of 292 AOB amoA gene sequences and 139 AOA amoA gene sequences were obtained from six clone libraries and were translated into amino acid sequences for analysis. The clone numbers for AOB in farm land, wild land, and tidal flats were 94, 102, and 97, respectively, while those for AOA in these three samples were 65, 39, and 35, respectively. These deduced amino acid sequences were grouped into OTUs based on 0.05 amino acid substitutions per amino acid position (Figs. 2 2 and 3 3 ). The Chao1 total estimators of AOB and AOA were calculated for bacterial and archaeal amoA genes using a 5% amino acid sequence divergence with randomly selected 35 sequences. The Chao1 values in each AOB sample from farm land, wild land, and tidal flats were 12, 11, and 8, respectively. Values of AOA for the three samples were 5, 7, and 9, respectively. There was a striking difference in bacterial and archaeal amoA gene diversities as measured by richness at the three soil development stages. The richness in the three soil development stage sites showed opposite trends for the bacterial and archaeal amoA genes. The greatest richness of the bacterial and archaeal amoA genes appeared in farm land and tidal flats, respectively. The estimated coverages of AOB for farm land, wild land, and tidal flats were 94%, 96%, and 98%, respectively. The values of AOA for the three samples were 98%, 95%, and 91%, respectively. Both the Nitrosomonas and Nitrosospira lineages of AOB were detected in this study (Fig. 2 2 ). Nearly all sequences from the tidal flats belonged to the Nitrosomonas lineage. In contrast, in farm land and wild land, more than half of the sequences belonged to the Nitrosospira lineage, and about 40% of sequences could be affiliated to the Nitrosomonas lineage. In AOB, the most abundant OTUs (clones BT_69_1, BW_88_1, and BF_89_1) were similar to the sequences of uncultured bacterium clones detected in different sources that were 95% similar to Nitrosomonas nitrosa (AF272404). Nearly one-third of the AOB deduced amino acid sequences of amoA gene in three soil development stages belonged to this OTU. The sequences belonging to the Nitrosospira lineage were almost all from farm land and wild land. Tidal flat: ●; Wild land: ▲; Farm land: ■. The first number in brackets is the number of the sequences which could be assigned to this OTU and the second number is the total sequence number of this clone library All sequences from AOA grouped within the Thaumarchaea (Fig. 3 3 ). The AOA community diversity was lower than that of AOB in this study. In tidal flats, 11% of sequences belonged to the water column/sediment cluster, related to Nitrosopumilus maritimus (HM345611); in wild land and farm land, respectively, 3% and 6% of all sequences belonged to this cluster, whereas the remainder fell within the soil/sediment cluster (Francis et al., 2005 2005 ). The most abundant OTUs were similar to sequences of uncultured Thaumarchaea , most of which have been detected in agricultural soils. About 80% of the sequences from farm land could be affiliated with the OTU AF_20_2. Tidal flat: ●; Wild land: ▲; Farm land: ■. The first number in brackets is the number of the sequences which could be assigned to this OTU and the second number is the total sequence number of this clone library Correlations between ammonia-oxidizing microbes and soil physicochemical properties 2 The relationships between AOB and AOA abundances and soil physicochemical properties were investigated using Pearson’s correlation coefficients (Table 3 3 ). The logs of both the AOB and AOA amoA gene copy numbers showed significant negative correlations with salinity ( R < 0.05). The abundances did not show significant correlations with other soil physicochemical properties in this analysis. AOB and AOA abundances were measured by real-time PCR of the amoA gene The Nitrosospira and Nitrosomonas lineages were calculated by the sequence proportion The sequence proportion of soil/sediment and water column/sediment lineage showed similar correlation so the results were combined Statistically significant correlations with a P value < 0.05 2 Parameter 5 Correlation coefficient AOB abundance a a AOA abundance a a Nitrosospira lineage b b Nitrosomonas lineage b b Soil/sediment and water column/sediment lineage c c Salinity −0.997 * * −0.999 * * −0.991 0.998 * * −0.911 Net nitrification rate 0.992 0.989 0.998 * * −0.990 0.976 pH −0.758 −0.775 −0.722 0.767 −0.492 Density 0.476 0.453 0.523 −0.464 0.746 Water content −0.696 −0.715 −0.656 0.706 −0.412 TC 0.680 0.698 0.639 −0.690 0.391 TN 0.744 0.761 0.707 −0.753 0.473 C/N ratio −0.931 −0.940 −0.910 0.936 −0.752 NH 4 + -N −0.734 −0.752 −0.697 0.744 −0.461 NO 3 − -N 0.422 0.446 0.373 −0.435 0.0902 The relationship between the major lineages of AOB and AOA and both soil chemical properties and potential net nitrification rates are shown in Table 3 3 . The Nitrosospira lineage showed a significant correlation with the net nitrification rate, while the Nitrosomonas lineage showed a significant correlation with salinity. The AOA lineages did not show any significant correlation with the soil physicochemical properties. Table 4 4 shows the R value between each of the two clone libraries of ANASIM analysis. The three sites exhibited different communities for both AOB and AOA. For AOB, the significant difference was observed mainly between tidal flats and farm and wild lands. There was no significant difference of AOB communities between farm land and wild land. For AOA, the results showed significant difference among communities in three sites. Clone library R value P value AOB in farm land and tidal flats 0.058 <0.001 AOB in farm land and wild land −0.001 0.445 AOB in tidal flats and wild land 0.047 0.002 AOA in farm land and tidal flats 0.190 0.001 AOA in farm land and wild land 0.214 <0.001 AOA in tidal flats and wild land 0.051 0.009 The correlations between soil physicochemical properties and the major AOB and AOA groups were analyzed using CA (Fig. 4 4 ). The results of CA showed similar relationships as those determined by the Pearson’s correlation coefficients. The AOB and AOA lineages appeared in the second and forth quadrants in addition to the net nitrification rate, density, pH, and salinity, indicating that these soil physicochemical properties must be important to the AOB and AOA lineages. The major lineages of AOB and AOA were showed by the red and yellow triangles, respectively. The soil physiochemical properties and net nitrification rates were showed by the blue triangle Discussion 1 Soil physicochemical properties 2 The soil physicochemical properties varied among the three soil development stages and were responsible for the variations in nitrification. In general, soil water content, pH, and NH 4 + -N content control nitrification (Paul and Clark, 1989 1989 ; Rhoades and Coleman, 1999 1999 ). Water in the tidal flats was a mixture of freshwater and seawater, having a high salinity. Effects of changes in physicochemical conditions along an estuarine gradient on nitrification rates have been well documented, indicating decreased nitrification as the salinity increases (Rysgaard et al., 1999 1999 ; Bernhard and Bollmann, 2010 2010 ), which was consistent with the change of nitrification rates in this study. Farm land was under a long-term reclamation, and thus the TN in the farm land was the highest. Salinity plays an important role in controlling NH 4 + -N adsorption capacity with increased NH 4 + -N efflux as salinity increases (Boynton and Kemp, 1985 1985 ). The general pattern of NH 4 + -N is higher in the high salinity areas and NO 3 − -N is enriched in the low salinity areas, which would be contributed by the difference of nitrification activity, and has been frequently observed in other estuaries (Windom and Niencheski, 2003 2003 ; Charette and Buesseler, 2004 2004 ; Santoro et al., 2008 2008 ) and is consistent with our results. Abundance and richness of ammonia oxidizers 2 In previous studies (Bernhard et al., 2005 2005 ; 2007 2007 ; Santoro et al., 2008 2008 ), AOB and AOA community compositions and abundances appear to vary with soil conditions, which also showed significant difference among AOA and AOB communities in the different soil development stages in this study. There was a dramatic difference in the abundances of AOB and AOA in the tidal flats. The abundances of both AOB and AOA showed a significant negative correlation with salinity, which is consistent with the results of previous studies covering estuaries salinity gradients (Bernhard et al., 2007 2007 ; Santoro et al., 2008 2008 ). Salinity is a particularly important parameter for ammonia oxidation, in part because of its influence on NH 4 + adsorption (Boatman and Murray, 1982 1982 ). It is thus reasonable that salinity has a strong influence on microbial community composition and size. It also has been proposed as potentially significant environmental divers of AOB and AOA abundance or community structure in various environments, especially in marine or estuary ecosystems (Sahan and Muyzer, 2008 2008 ; Santoro et al., 2008 2008 ). In both the farm land and wild land, AOA outnumbered AOB. This finding is consistent with the results of other reports (Leininger et al., 2006 2006 ; Zhang et al., 2010 2010 ). One intriguing result was that AOA were not detected in the tidal flats using real-time PCR even though they were detected using normal PCR. This primer set used in real-time PCR was widely used in previous studies (Leininger et al., 2006 2006 ; Boyle-Yarwood et al., 2008 2008 ; Mertens et al., 2009 2009 ). Furthermore, when comparing the primer set sequences to the sequences achieved from clone libraries of AOA, they matched perfectly. It means that the real-time PCR conditions for AOA analysis are appropriate for amplification. Some reports specifically described the low sensitivity of real-time PCR compared with normal PCR (Hafez et al., 2005 2005 ; Bastien et al., 2008 2008 ). Hence, real-time PCR is not always more sensitive than normal PCR. Therefore, the result of a decrease in the abundance of AOA in the tidal flats was still credible. As the decrease of AOB and AOA abundance in tidal flats, net nitrification rate in tidal flats was also observed lower than that in farm and wild lands, indicating that the decrease of ammonia oxidizer’s activity in tidal flats. Although previous studies have suggested that in soil environments AOA are often more diverse and abundant than AOB (Santoro et al., 2008 2008 ; Zhang et al., 2010 2010 ), our results revealed a lower richness of AOA than that of AOB in the three soil development stages. Community diversities of AOA and AOB 2 Previous studies have suggested the predominance of Nitrosospira over Nitrosomonas in terrestrial ecosystems (Kowalchuk et al., 2000 2000 ; Avrahami et al., 2002 2002 ; Avrahami and Conrad, 2003 2003 ). Both lineages of AOB were detected in this study. The sequences of the bacterial amoA genes in farm land and wild land were consistent with the reported results. Interestingly, no Nitrosospira -like sequence was found in the saline tidal flats site. Of the physicochemical parameters, salinity and the net nitrification rate of the farm land and wild land showed significant differences from those of tidal flats (Table 2 2 ), indicating that the salinity and the net nitrification rate can be the important factors determining the AOB assemblages in different soil development stages. The results of CA (Fig. 4 4 ) showed that the proportion of Nitrosomonas lineages was positively correlated with salinity and negatively correlated with net nitrification rate, density, and pH. The enormous differences in the AOB communities among the first soil stage of the tidal flats, the last stage of farm land, and the middle development stage of wild land revealed a difference with respect to the soil development stage. Several studies concerning the factors affecting the distribution of AOB have suggested that salinity is one of the important factors (Bernhard et al., 2005 2005 ; 2007 2007 ), which was supported by the results of this study. Members of the Nitrosospira lineage were only detected in the farm land and wild land. However, the Nitrosospira lineage is often dominant in salty environments such as estuarine or marine systems (Ward et al., 2007 2007 ; Bernhard and Bollmann, 2010 2010 ). An estuarine environment is the interface of land, freshwater and marine environments (Dang et al., 2010 2010 ). Tidal flats in this study are coastal wetlands which are different from the study site of the Yangtze River estuary (Dang et al., 2010 2010 ), so the result of no Nitrosospira- like sequences in tidal flats was not surprising. On the other hand, in studies which were focused on agricultural soil AOB communities (Chu et al., 2007 2007 ; Chen et al., 2008 2008 ), the Nitrosospira lineage was also found to be dominant in agricultural soils. In our results, more than half of the sequences from farm land and wild land belonged to the Nitrosomonas lineage, and the tidal flats were also dominated by Nitrosomonas . Those results indicated that the tidal flats are significantly different from the developed soil stages. Nitrosomonas has been detected in high-ammonia environments, such as sediment from surface-flow wetland mesocosms (Allen et al., 2010 2010 ), manure-treated wetlands (Ibekwe et al., 2003 2003 ), and waste water treatment plants (Park et al., 2006 2006 ), which is coincident with the higher ammonia content of the tidal flats than that of farm land and wild land. The differences in the AOB community structure can be used as a biological indicator of different soil development stages. Phylogenetic analysis reveals a high AOB diversity in three soil development stages. The most abundant bacterial amoA sequence types (clones BT_69_1, BW_88_1, and BF_89_1) of the three sites were from the Nitrosomonas lineage. This type of sequence was found to predominate in different sources such as agriculture soil (Wang et al., 2009 2009 ), wetland water sample (Dorador et al., 2008 2008 ), and estuary sediment (Sahan and Muyzer, 2008 2008 ). In the three different soil development stages, about one-third of AOB amoA gene sequences belonged to this type, indicating that this type of Nitrosomonas is distributed equally in the different environments. In the Nitrosomonas lineage, the second most abundant bacterial amoA gene sequence type (clone BT_60_1) was affiliated with the Nitrosomonas marina cluster but with more than 6% dissimilarity with respect to the isolated Nitrosomonas marina . All sequences belonging to this type were from the tidal flats. This type was seldom detected in soil and is typically detected in marine-related environments, such as coastal sediments (Dang et al., 2010 2010 ) and estuaries (Purkhold et al., 2003 2003 ). The water in tidal flats is mixed freshwater and seawater. Some soil characteristics, such as salinity and water content, of the tidal flats are more similar to those of marine environments than those of farm land and wild land. Although most marine environments show relatively high proportions of Nitrosospira lineage of AOB, the most abundant sequence type in the Nitrosospira lineage detected in this study has most often been detected in agriculture soil in previous studies (Chu et al., 2007 2007 ; Wang et al., 2009 2009 ), which is consistent with the soil development stages of farm land and wild land. The AOA community diversity was lower than that for AOB in this study. Most of the sequences from the three soil development stages could be affiliated with the soil/sediment cluster, and were closely related to sequences identified in studies of soil and sediment (Leininger et al., 2006 2006 ; Shen et al., 2008 2008 ; Zhang et al., 2009 2009 ), suggesting a similar environment globally. The AOA diversities did not show significant differences among the three soil development stages. However, it had no obvious correlation with the differences in the soil physicochemical properties. As for the results of CA (Fig. 4 4 ), the percentage of soil/sediment lineage was positively correlated with net nitrification rate, density, and pH and negatively correlated with salinity. Conclusions 1 The results of this study showed that salinity, pH, and net nitrification rate in different soil development stages had a greater influence on the abundances and community compositions of AOB and AOA than other soil physicochemical properties in different soil development stages of tidal flats. However, AOB and AOA displayed differences in the response to the different soil development stages. Among the AOB, the ratio of the number of sequences belonging to Nitrosomonas and Nitrosospira showed significant correlations with salinity and net nitrification rates, which showed significant differences between the primary soil and agricultural soil. In contrast, the AOA community composition showed no significant correlation with soil development stage. The differences in the AOB community structure can be used as a biological indicator of different soil development stages, which could be used to monitor the resource utilization of tidal flats. References JG Allen , MW Beutel , DR Call , AM Fischer . Effects of oxygenation on ammonia oxidation potential and microbial diversity in sediment from surface-flow wetland mesocosms . Bioresour Technol , 2010 . 101 ( 4 ): 1389 - 1392 . 19815408 DOI: 10.1016/j.biortech.2009.09.050 http://doi.org/10.1016/j.biortech.2009.09.050 . Effects of oxygenation on ammonia oxidation potential and microbial diversity in sediment from surface-flow wetland mesocosms S Avrahami , R Conrad . Patterns of community change among ammonia oxidizers in meadow soils upon long-term incubation at different temperatures . Appl Environ Microbiol , 2003 . 69 ( 10 ): 6152 - 6164 . 14532075 DOI: 10.1128/AEM.69.10.6152-6164.2003 http://doi.org/10.1128/AEM.69.10.6152-6164.2003 . Patterns of community change among ammonia oxidizers in meadow soils upon long-term incubation at different temperatures S Avrahami , R Conrad , G Braker . Effect of soil ammonium concentration on N 2 O release and on the community structure of ammonia oxidizers and denitrifiers . Appl Environ Microbiol , 2002 . 68 ( 11 ): 5685 - 5692 . 12406765 DOI: 10.1128/AEM.68.11.5685-5692.2002 http://doi.org/10.1128/AEM.68.11.5685-5692.2002 . Effect of soil ammonium concentration on N2O release and on the community structure of ammonia oxidizers and denitrifiers F Bastida , A Zsolnay , T Hernandez , C Garcia . Past, present and future of soil quality indices: a biological perspective . Geoderma , 2008 . 147 ( 3-4 ): 159 - 171 . DOI: 10.1016/j.geoderma.2008.08.007 http://doi.org/10.1016/j.geoderma.2008.08.007 . Past, present and future of soil quality indices: a biological perspective P Bastien , GW Procop , U Reischl . Quantitative real-time PCR is not more sensitive than “conventional” PCR . J Clin Microbiol , 2008 . 46 ( 6 ): 1897 - 1900 . 18400914 DOI: 10.1128/JCM.02258-07 http://doi.org/10.1128/JCM.02258-07 . Quantitative real-time PCR is not more sensitive than “conventional” PCR AE Bernhard , A Bollmann . Estuarine nitrifiers: new player, patterns and processes . Estuar Coast Shelf Sci , 2010 . 88 ( 1 ): 1 - 11 . DOI: 10.1016/j.ecss.2010.01.023 http://doi.org/10.1016/j.ecss.2010.01.023 . Estuarine nitrifiers: new player, patterns and processes AE Bernhard , T Donn , AE Giblin , DA Stahl . Loss of diversity of ammonia-oxidizing bacteria correlates with increasing salinity in an estuary system . Environ Microbiol , 2005 . 7 ( 9 ): 1289 - 1297 . 16104852 DOI: 10.1111/j.1462-2920.2005.00808.x http://doi.org/10.1111/j.1462-2920.2005.00808.x . Loss of diversity of ammonia-oxidizing bacteria correlates with increasing salinity in an estuary system AE Bernhard , J Tucker , AE Giblin , DA Stahl . Functionally distinct communities of ammonia-oxidizing bacteria along an estuarine salinity gradient . Environ Microbiol , 2007 . 9 ( 6 ): 1439 - 1447 . 17504481 DOI: 10.1111/j.1462-2920.2007.01260.x http://doi.org/10.1111/j.1462-2920.2007.01260.x . Functionally distinct communities of ammonia-oxidizing bacteria along an estuarine salinity gradient CD Boatman , JW Murray . Modeling exchangeable NH 4 + adsorption in marine sediments: process and controls of adsorption . Limnol Oceanogr , 1982 . 27 ( 1 ): 99 - 110 . DOI: 10.4319/lo.1982.27.1.0099 http://doi.org/10.4319/lo.1982.27.1.0099 . Modeling exchangeable NH4+ adsorption in marine sediments: process and controls of adsorption SA Boyle-Yarwood , PJ Bottomley , DD Myrold . Community composition of ammonia-oxidizing bacteria and archaea in soils under stands of red alder and Douglas fir in Oregon . Environ Microbiol , 2008 . 10 ( 11 ): 2956 - 2965 . 18393992 DOI: 10.1111/j.1462-2920.2008.01600.x http://doi.org/10.1111/j.1462-2920.2008.01600.x . Community composition of ammonia-oxidizing bacteria and archaea in soils under stands of red alder and Douglas fir in Oregon WR Boynton , WM Kemp . Nutrient regeneration and oxygen consumption by sediments along an estuarine salinity gradient . Mar Ecol Prog Ser , 1985 . 23 45 - 55 . DOI: 10.3354/meps023045 http://doi.org/10.3354/meps023045 . Nutrient regeneration and oxygen consumption by sediments along an estuarine salinity gradient C Brochier-Armanet , B Boussau , S Gribaldo , P Forterre . Mesophilic crenarchaeota: proposal for a third archaeal phylum, the Thaumarchaeota . Nat Rev Microbiol , 2008 . 6 ( 3 ): 245 - 252 . 18274537 DOI: 10.1038/nrmicro1852 http://doi.org/10.1038/nrmicro1852 . Mesophilic crenarchaeota: proposal for a third archaeal phylum, the Thaumarchaeota MA Charette , KO Buesseler . Submarine groundwater discharge of nutrients and copper to an urban subestuary of Chesapeake Bay (Elizabeth River) . Limnol Oceanogr , 2004 . 49 ( 2 ): 376 - 385 . DOI: 10.4319/lo.2004.49.2.0376 http://doi.org/10.4319/lo.2004.49.2.0376 . Submarine groundwater discharge of nutrients and copper to an urban subestuary of Chesapeake Bay (Elizabeth River) XP Chen , YG Zhu , Y Xia , JP Shen , JZ He . Ammonia-oxidizing archaea: important players in paddy rhizosphere soil? . Environ Microbiol , 2008 . 10 ( 8 ): 1978 - 1987 . 18430011 DOI: 10.1111/j.1462-2920.2008.01613.x http://doi.org/10.1111/j.1462-2920.2008.01613.x . Ammonia-oxidizing archaea: important players in paddy rhizosphere soil? HY Chu , T Fujii , S Morimoto , XG Lin , K Yagi , JL Hu , JB Zhang . Community structure of ammonia-oxidizing bacteria under long-term application of mineral fertilizer and organic manure in a sandy loam soil . Appl Environ Microbiol , 2007 . 73 ( 2 ): 485 - 491 . 17098920 DOI: 10.1128/AEM.01536-06 http://doi.org/10.1128/AEM.01536-06 . Community structure of ammonia-oxidizing bacteria under long-term application of mineral fertilizer and organic manure in a sandy loam soil HY Dang , J Li , RP Chen , L Wang , LZ Guo , ZN Zhang , MG Klotz . Diversity, abundance, and spatial distribution of sediment ammonia-oxidizing betaproteobacteria in response to environmental gradients and coastal eutrophication in Jiaozhou Bay, China . Appl Environ Microbiol , 2010 . 76 ( 14 ): 4691 - 4702 . 20511433 DOI: 10.1128/AEM.02563-09 http://doi.org/10.1128/AEM.02563-09 . Diversity, abundance, and spatial distribution of sediment ammonia-oxidizing betaproteobacteria in response to environmental gradients and coastal eutrophication in Jiaozhou Bay, China HJ Di , KC Cameron , JP Shen , CS Winefield , M O′Callaghan , S Bowatte , JZ He . Ammonia-oxidizing bacteria and archaea grow under contrasting soil nitrogen conditions . FEMS Microbiol Ecol , 2010 . 72 ( 3 ): 386 - 394 . 20370827 DOI: 10.1111/j.1574-6941.2010.00861.x http://doi.org/10.1111/j.1574-6941.2010.00861.x . Ammonia-oxidizing bacteria and archaea grow under contrasting soil nitrogen conditions C Dorador , A Busekow , I Vila , JF Imhoff , KP Witzel . Molecular analysis of enrichment cultures of ammonia oxidizers from the Salar de Huasco, a high altitude saline wetland in northern Chile . Extremophiles , 2008 . 12 ( 3 ): 405 - 414 . 18305895 DOI: 10.1007/s00792-008-0146-x http://doi.org/10.1007/s00792-008-0146-x . Molecular analysis of enrichment cultures of ammonia oxidizers from the Salar de Huasco, a high altitude saline wetland in northern Chile K Enwall , L Philippot , S Hallin . Activity and composition of the denitrifying bacterial community respond differently to long-term fertilization . Appl Environ Microbiol , 2005 . 71 ( 12 ): 8335 - 8343 . 16332820 DOI: 10.1128/AEM.71.12.8335-8343.2005 http://doi.org/10.1128/AEM.71.12.8335-8343.2005 . Activity and composition of the denitrifying bacterial community respond differently to long-term fertilization IJ Fernandez , JA Simmons , RD Briggs . Indices of forest floor nitrogen status along a climate gradient in Maine, USA . For Ecol Manage , 2000 . 134 ( 1-3 ): 177 - 187 . DOI: 10.1016/S0378-1127(99)00256-X http://doi.org/10.1016/S0378-1127(99)00256-X . Indices of forest floor nitrogen status along a climate gradient in Maine, USA N Fierer , RB Jackson . The diversity and biogeography of soil bacterial communities . PNAS , 2006 . 103 ( 3 ): 626 - 631 . 16407148 DOI: 10.1073/pnas.0507535103 http://doi.org/10.1073/pnas.0507535103 . The diversity and biogeography of soil bacterial communities CA Francis , KJ Roberts , JM Beman , AE Santoro , BB Oakley . Ubiquity and diversity of ammonia-oxidizing archaea in water columns and sediments of the ocean . PNAS , 2005 . 102 ( 41 ): 14683 - 14688 . 16186488 DOI: 10.1073/pnas.0506625102 http://doi.org/10.1073/pnas.0506625102 . Ubiquity and diversity of ammonia-oxidizing archaea in water columns and sediments of the ocean XJ Gan , YT Cai , CY Choi , ZJ Ma , JK Chen , B Li . Potential impacts of invasive Spartina alterniflora on spring bird communities at Chongming Dongtan, a Chinese wetland of international importance . Estuar Coast Shelf Sci , 2009 . 83 ( 2 ): 211 - 218 . DOI: 10.1016/j.ecss.2009.03.026 http://doi.org/10.1016/j.ecss.2009.03.026 . Potential impacts of invasive Spartina alterniflora on spring bird communities at Chongming Dongtan, a Chinese wetland of international importance Y Gao , B Zhao . The effect of reclamation on mud flat development in Chongming Island, Shanghai . Chin Agric Sci Bull , 2006 . 22 ( 8 ): 475 - 479 . (in Chinese) . The effect of reclamation on mud flat development in Chongming Island, Shanghai MS Girvan , J Bullimore , JN Pretty , AM Osborn , AS Ball . Soil type is the primary determinant of the composition of the total and active bacterial communities in arable soils . Appl Environ Microbiol , 2003 . 69 ( 3 ): 1800 - 1809 . 12620873 DOI: 10.1128/AEM.69.3.1800-1809.2003 http://doi.org/10.1128/AEM.69.3.1800-1809.2003 . Soil type is the primary determinant of the composition of the total and active bacterial communities in arable soils IJ Good . The population frequencies of species and the estimation of population parameters . Biometrika , 1953 . 40 ( 3-4 ): 237 - 264 . DOI: 10.1093/biomet/40.3-4.237 http://doi.org/10.1093/biomet/40.3-4.237 . The population frequencies of species and the estimation of population parameters HM Hafez , R Hauck , D Lüschow , L McDougald . Comparison of the specificity and sensitivity of PCR, nested PCR, and real-time PCR for the diagnosis of histomoniasis . Avian Dis , 2005 . 49 ( 3 ): 366 - 370 . 16252489 DOI: 10.1637/7341-020805R.1 http://doi.org/10.1637/7341-020805R.1 . Comparison of the specificity and sensitivity of PCR, nested PCR, and real-time PCR for the diagnosis of histomoniasis TA Hall . BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT . Nucleic Acids Symp Ser , 1999 . 41 95 - 98 . . BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT JZ He , JP Shen , LM Zhang , YG Zhu , YM Zheng , MG Xu , H Di . Quantitative analyses of the abundance and composition of ammonia-oxidizing bacteria and ammonia-oxidizing archaea of a Chinese upland red soil under long-term fertilization practices . Environ Microbiol , 2007 . 9 ( 9 ): 2364 - 2374 . 17686032 DOI: 10.1111/j.1462-2920.2007.01358.x http://doi.org/10.1111/j.1462-2920.2007.01358.x . Quantitative analyses of the abundance and composition of ammonia-oxidizing bacteria and ammonia-oxidizing archaea of a Chinese upland red soil under long-term fertilization practices IM Head , WD Hiorns , TM Embley , AJ McCarthy , JR Saunders . The phylogeny of autotrophic ammonia-oxdizing bacteria as determined by analysis of 16S ribosomal-RNA gene-sequences . Microbiology , 1993 . 139 ( 6 ): 1147 - 1153 . DOI: 10.1099/00221287-139-6-1147 http://doi.org/10.1099/00221287-139-6-1147 . The phylogeny of autotrophic ammonia-oxdizing bacteria as determined by analysis of 16S ribosomal-RNA gene-sequences AM Ibekwe , CM Grieve , SR Lyon . Characterization of microbial communities and composition in constructed dairy wetland wastewater effluent . Appl Environ Microbiol , 2003 . 69 ( 9 ): 5060 - 5069 . 12957887 DOI: 10.1128/AEM.69.9.5060-5069.2003 http://doi.org/10.1128/AEM.69.9.5060-5069.2003 . Characterization of microbial communities and composition in constructed dairy wetland wastewater effluent F Jeanmougin , JD Thompson , M Gouy , DG Higgins , TJ Gibson . Multiple sequence alignment with Clustal X . Trends Biochem Sci , 1998 . 23 ( 10 ): 403 - 405 . 9810230 DOI: 10.1016/S0968-0004(98)01285-7 http://doi.org/10.1016/S0968-0004(98)01285-7 . Multiple sequence alignment with Clustal X ZJ Jia , R Conrad . Bacteria rather than archaea dominate microbial ammonia oxidation in an agricultural soil . Environ Microbiol , 2009 . 11 ( 7 ): 1658 - 1671 . 19236445 DOI: 10.1111/j.1462-2920.2009.01891.x http://doi.org/10.1111/j.1462-2920.2009.01891.x . Bacteria rather than archaea dominate microbial ammonia oxidation in an agricultural soil CN Kelly , SH Schoenholtz , MB Adams . Soil properties associated with net nitrification following watershed conversion from Appalachian hardwoods to Norway spruce . Plant Soil , 2011 . 344 ( 1-2 ): 361 - 376 . DOI: 10.1007/s11104-011-0755-5 http://doi.org/10.1007/s11104-011-0755-5 . Soil properties associated with net nitrification following watershed conversion from Appalachian hardwoods to Norway spruce M Könneke , A Bernhard , J de la Torre , C Walker , J Waterbury , D Stahl . Isolation of an autotrophic ammonia-oxidizing marine archaeon . Nature , 2005 . 437 ( 7058 ): 543 - 546 . 16177789 DOI: 10.1038/nature03911 http://doi.org/10.1038/nature03911 . Isolation of an autotrophic ammonia-oxidizing marine archaeon GA Kowalchuk , AW Stienstra , GHJ Heilig , JR Stephen , JW Woldendorp . Changes in the community structure of ammonia-oxidizing bacteria during secondary succession of calcareous grasslands . Environ Microbiol , 2000 . 2 ( 1 ): 99 - 110 . 11243267 DOI: 10.1046/j.1462-2920.2000.00080.x http://doi.org/10.1046/j.1462-2920.2000.00080.x . Changes in the community structure of ammonia-oxidizing bacteria during secondary succession of calcareous grasslands S Kumar , K Tamura , M Nei . MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment . Brief Bioinformatics , 2004 . 5 ( 2 ): 150 - 163 . 15260895 DOI: 10.1093/bib/5.2.150 http://doi.org/10.1093/bib/5.2.150 . MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment S Leininger , T Urich , M Schloter , L Schwark , J Qi , GW Nicol , JI Prosser , SC Schuster , C Schleper . Archaea predominate among ammonia-oxidizing prokaryotes in soils . Nature , 2006 . 442 ( 7104 ): 806 - 809 . 16915287 DOI: 10.1038/nature04983 http://doi.org/10.1038/nature04983 . Archaea predominate among ammonia-oxidizing prokaryotes in soils X Li , YX Zhou , RY Kuang . Analysis and trend prediction of shoreline evolution in Chongming Dongtan, Shanghai . J Jilin Univ , 2010 . 40 417 - 424 . (in Chinese) . Analysis and trend prediction of shoreline evolution in Chongming Dongtan, Shanghai J Mertens , K Broos , SA Wakelin , GA Kowalchuk , D Springael , E Smolders . Bacteria, not archaea, restore nitrification in a zinc-contaminated soil . ISME J , 2009 . 3 ( 8 ): 916 - 923 . 19387487 DOI: 10.1038/ismej.2009.39 http://doi.org/10.1038/ismej.2009.39 . Bacteria, not archaea, restore nitrification in a zinc-contaminated soil NS Moin , KA Nelson , A Bush , AE Bernhard . Distribution and diversity of archaeal and bacterial ammonia oxidizers in salt marsh sediments . Appl Environ Microbiol , 2009 . 75 ( 23 ): 7461 - 7468 . 19801456 DOI: 10.1128/aem.01001-09 http://doi.org/10.1128/aem.01001-09 . Distribution and diversity of archaeal and bacterial ammonia oxidizers in salt marsh sediments RJ Norman , JW Stucki . The determination of nitrate and nitrite in soil extracts by ultraviolet spectrophotometry . Soil Sci Soc Am J , 1981 . 45 ( 2 ): 347 - 353 . . The determination of nitrate and nitrite in soil extracts by ultraviolet spectrophotometry HD Park , GF Wells , H Bae , CS Criddle , CA Francis . Occurrence of ammonia-oxidizing archaea in wastewater treatment plant bioreactors . Appl Environ Microbiol , 2006 . 72 ( 8 ): 5643 - 5647 . 16885322 DOI: 10.1128/AEM.00402-06 http://doi.org/10.1128/AEM.00402-06 . Occurrence of ammonia-oxidizing archaea in wastewater treatment plant bioreactors EA Paul , FE Clark . Soil Microbiology and Biochemistry , 1989 . : San Diego Academic Press , . Soil Microbiology and Biochemistry U Purkhold , A Pommerening-Röser , S Juretschko , MC Schmid , HP Koops , M Wagner . Phylogeny of all recognized species of ammonia oxidizers based on comparative 16S rRNA and amoA sequence analysis: implications for molecular diversity surveys . Appl Environ Microbiol , 2000 . 66 ( 12 ): 5368 - 5382 . 11097916 DOI: 10.1128/AEM.66.12.5368-5382.2000 http://doi.org/10.1128/AEM.66.12.5368-5382.2000 . Phylogeny of all recognized species of ammonia oxidizers based on comparative 16S rRNA and amoA sequence analysis: implications for molecular diversity surveys U Purkhold , M Wagner , G Timmermann , A Pommerening-Roser , HP Koops . 16S rRNA and amoA -based phylogeny of 12 novel betaproteobacterial ammonia-oxidizing isolates: extension of the dataset and proposal of a new lineage within the nitrosomonads . Int J Syst Evol Microbiol , 2003 . 53 ( 5 ): 1485 - 1494 . 13130037 DOI: 10.1099/ijs.0.02638-0 http://doi.org/10.1099/ijs.0.02638-0 . 16S rRNA and amoA-based phylogeny of 12 novel betaproteobacterial ammonia-oxidizing isolates: extension of the dataset and proposal of a new lineage within the nitrosomonads CC Rhoades , DC Coleman . Nitrogen mineralization and nitrification following land conversion in montane Ecuador . Soil Biol Biochem , 1999 . 31 ( 10 ): 1347 - 1354 . DOI: 10.1016/S0038-0717(99)00037-1 http://doi.org/10.1016/S0038-0717(99)00037-1 . Nitrogen mineralization and nitrification following land conversion in montane Ecuador JH Rotthauwe , KP Witzel , W Liesack . The ammonia monooxygenase structural gene amoA as a functional marker: molecular fine-scale analysis of natural ammonia-oxidizing populations . Appl Environ Microbiol , 1997 . 63 ( 12 ): 4704 - 4712 . 9406389 . The ammonia monooxygenase structural gene amoA as a functional marker: molecular fine-scale analysis of natural ammonia-oxidizing populations S Rysgaard , P Thastum , T Dalsgaard , PB Christensen , NP Sloth . Effects of salinity on NH 4 + adsorption capacity, nitrification, and dentrification in Danish estuarine sediments . Estuaries , 1999 . 22 ( 1 ): 21 - 30 . DOI: 10.2307/1352923 http://doi.org/10.2307/1352923 . Effects of salinity on NH4+ adsorption capacity, nitrification, and dentrification in Danish estuarine sediments E Sahan , G Muyzer . Diversity and spatio-temporal distribution of ammonia-oxidizing archaea and bacteria in sediments of the Westerschelde estuary . FEMS Microbiol Ecol , 2008 . 64 ( 2 ): 175 - 186 . 18336555 DOI: 10.1111/j.1574-6941.2008.00462.x http://doi.org/10.1111/j.1574-6941.2008.00462.x . Diversity and spatio-temporal distribution of ammonia-oxidizing archaea and bacteria in sediments of the Westerschelde estuary AE Santoro , CA Francis , NR de Sieyes , AB Boehm . Shifts in the relative abundance of ammonia-oxidizing bacteria and archaea across physicochemical gradients in a subterranean estuary . Environ Microbiol , 2008 . 10 ( 4 ): 1068 - 1079 . 18266758 DOI: 10.1111/j.1462-2920.2007.01547.x http://doi.org/10.1111/j.1462-2920.2007.01547.x . Shifts in the relative abundance of ammonia-oxidizing bacteria and archaea across physicochemical gradients in a subterranean estuary PD Schloss , SL Westcott , T Ryabin , JR Hall , M Hartmann , EB Hollister , RA Lesniewski , BB Oakley , DH Parks , CJ Robinson , 等 . Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities . Appl Environ Microbiol , 2009 . 75 ( 23 ): 7537 - 7541 . 19801464 DOI: 10.1128/AEM.01541-09 http://doi.org/10.1128/AEM.01541-09 . Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities J Sharp , J Pennock , T Church , 等 . VS Kennedy . The Estuarine Interaction of Nutrients, Organics, and Metals: A Case Study in the Delaware Estuary . The Estuary as a Filter , 1984 . : New York Academic Press , 241 - 258 . . The Estuarine Interaction of Nutrients, Organics, and Metals: A Case Study in the Delaware Estuary JP Shen , LM Zhang , YG Zhu , JB Zhang , JZ He . Abundance and composition of ammonia-oxidizing bacteria and ammonia-oxidizing archaea communities of an alkaline sandy loam . Environ Microbiol , 2008 . 10 ( 6 ): 1601 - 1611 . 18336563 DOI: 10.1111/j.1462-2920.2008.01578.x http://doi.org/10.1111/j.1462-2920.2008.01578.x . Abundance and composition of ammonia-oxidizing bacteria and ammonia-oxidizing archaea communities of an alkaline sandy loam L Solorzano . Determination of ammonia in natural waters by the phenolhypochlorite method . Limnol Oceanogr , 1969 . 14 ( 5 ): 799 - 801 . . Determination of ammonia in natural waters by the phenolhypochlorite method A Spang , R Hatzenpichler , C Brochier-Armanet , T Rattei , P Tischler , E Spieck , W Streit , DA Stahl , M Wagner , C Schleper . Distinct gene set in two different lineages of ammonia-oxidizing archaea supports the phylum Thaumarchaeota . Trends Microbiol , 2010 . 18 ( 8 ): 331 - 340 . 20598889 DOI: 10.1016/j.tim.2010.06.003 http://doi.org/10.1016/j.tim.2010.06.003 . Distinct gene set in two different lineages of ammonia-oxidizing archaea supports the phylum Thaumarchaeota AH Treusch , S Leininger , A Kletzin , SC Schuster , HP Klenk , C Schleper . Novel genes for nitrite reductase and Amo-related proteins indicate a role of uncultivated mesophilic crenarchaeota in nitrogen cycling . Environ Microbiol , 2005 . 7 ( 12 ): 1985 - 1995 . 16309395 DOI: 10.1111/j.1462-2920.2005.00906.x http://doi.org/10.1111/j.1462-2920.2005.00906.x . Novel genes for nitrite reductase and Amo-related proteins indicate a role of uncultivated mesophilic crenarchaeota in nitrogen cycling J Venter , K Remington , J Heidelberg , A Halpern , D Rusch , J Eisen , D Wu , I Paulsen , K Nelson , W Nelson , 等 . Environmental genome shotgun sequencing of the Sargasso Sea . Science , 2004 . 304 ( 5667 ): 66 - 74 . 15001713 DOI: 10.1126/science.1093857 http://doi.org/10.1126/science.1093857 . Environmental genome shotgun sequencing of the Sargasso Sea YA Wang , XB Ke , LQ Wu , YH Lu . Community composition of ammonia-oxidizing bacteria and archaea in rice field soil as affected by nitrogen fertilization . Syst Appl Microbiol , 2009 . 32 ( 1 ): 27 - 36 . 19091507 DOI: 10.1016/j.syapm.2008.09.007 http://doi.org/10.1016/j.syapm.2008.09.007 . Community composition of ammonia-oxidizing bacteria and archaea in rice field soil as affected by nitrogen fertilization BB Ward , GD O′Mullan . Worldwide distribution of Nitrosococcus oceani , a marine ammonia-oxidizing gamma-proteobacterium, detected by PCR and sequencing of 16S rRNA and amoA genes . Appl Environ Microbiol , 2002 . 68 ( 8 ): 4153 - 4157 . 12147525 DOI: 10.1128/AEM.68.8.4153-4157.2002 http://doi.org/10.1128/AEM.68.8.4153-4157.2002 . Worldwide distribution of Nitrosococcus oceani, a marine ammonia-oxidizing gamma-proteobacterium, detected by PCR and sequencing of 16S rRNA and amoA genes BB Ward , D Evelllard , JD Klrshteln , JD Nelson , MA Voytek , GA Jackson . Ammonia-oxidizing bacterial community composition in estuarine and oceanic environments assessed using a functional gene microarray . Environ Microbiol , 2007 . 9 ( 10 ): 2522 - 2538 . 17803777 DOI: 10.1111/j.1462-2920.2007.01371.x http://doi.org/10.1111/j.1462-2920.2007.01371.x . Ammonia-oxidizing bacterial community composition in estuarine and oceanic environments assessed using a functional gene microarray GF Wells , HD Park , CH Yeung , B Eggleston , CA Francis , CS Criddle . Ammonia-oxidizing communities in a highly aerated full-scale activated sludge bioreactor: betaproteobacterial dynamics and low relative abundance of Crenarchaea . Environ Microbiol , 2009 . 11 ( 9 ): 2310 - 2328 . 19515200 DOI: 10.1111/j.1462-2920.2009.01958.x http://doi.org/10.1111/j.1462-2920.2009.01958.x . Ammonia-oxidizing communities in a highly aerated full-scale activated sludge bioreactor: betaproteobacterial dynamics and low relative abundance of Crenarchaea H Windom , F Niencheski . Biogeochemical processes in a freshwater-seawater mixing zone in permeable sediments along the coast of Southern Brazil . Mar Chem , 2003 . 83 ( 3-4 ): 121 - 130 . DOI: 10.1016/S0304-4203(03)00106-3 http://doi.org/10.1016/S0304-4203(03)00106-3 . Biogeochemical processes in a freshwater-seawater mixing zone in permeable sediments along the coast of Southern Brazil LM Zhang , M Wang , JI Prosser , YM Zheng , JZ He . Altitude ammonia-oxidizing bacteria and archaea in soils of Mount Everest . FEMS Microbiol Ecol , 2009 . 70 ( 2 ): 208 - 217 . DOI: 10.1111/j.1574-6941.2009.00775.x http://doi.org/10.1111/j.1574-6941.2009.00775.x . Altitude ammonia-oxidizing bacteria and archaea in soils of Mount Everest LM Zhang , PR Offre , JZ He , DT Verhamme , GW Nicol , JI Prosser . Autotrophic ammonia oxidation by soil thaumarchaea . PNAS , 2010 . 107 ( 40 ): 17240 - 17245 . 20855593 DOI: 10.1073/pnas.1004947107 http://doi.org/10.1073/pnas.1004947107 . Autotrophic ammonia oxidation by soil thaumarchaea J Zhou , MA Bruns , JM Tiedje . DNA recovery from soils of diverse composition . Appl Environ Microbiol , 1996 . 62 ( 2 ): 316 - 322 . 8593035 . DNA recovery from soils of diverse composition 10.1631/jzus.B1200013 Project supported by the National Natural Science Foundation of China (Nos. 31070097 and 31011140339), the National Key Technologies R&D Program of China (Nos. 2006BAJ05A11 and 2010BAK69B14), and the Major Program of Science and Technology Department of Shanghai (No. 10DZ1200700), China 2012-01-10 2012-09-06 2012-05-30 2022-01-05 Copyright © Zhejiang University and Springer-Verlag Berlin Heidelberg 2012 2012 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 10 13