Molecular authentication of geo-authentic Scrophularia ningpoensis

Molecular authentication of geo-authentic Scrophularia ningpoensis 1 2 first-author 1 2 3 3 1 2 corresp ‡Corresponding Author ‡Corresponding Author †E-mail:cxfu@zju.edu.cn †E-mail:cxfu@zju.edu.cn cxfu@zju.edu.cn Key Laboratory of Conservation Biology for Endangered Wildlife of Ministry of Education, College of Life Sciences, Zhejiang University, Hangzhou 310058, China Key Laboratory of Conservation Biology for Endangered Wildlife of Ministry of Education, College of Life Sciences, Zhejiang University, Hangzhou 310058, China Laboratory of Systematic and Evolutionary Botany and Biodiversity, Institute of Plant Sciences and Conservation Center for Gene Resources of Endangered Wildlife, Zhejiang University, Hangzhou 310058, China Laboratory of Systematic and Evolutionary Botany and Biodiversity, Institute of Plant Sciences and Conservation Center for Gene Resources of Endangered Wildlife, Zhejiang University, Hangzhou 310058, China Pan’an Institute of Traditional Chinese Medicine, Pan’an 322300, China Pan’an Institute of Traditional Chinese Medicine, Pan’an 322300, China Scrophularia ningpoensis has long been used in the Chinese Materia Medica for inflammation. Like other herbal medicines, S. ningpoensis collected from different localities may considerably differ in their therapeutic efficacy, and the one grown in Zhejiang Province is recognized as geo-authentic. However, it is difficult to confirm the geographical authenticity by similar morphological characteristics. In the present study, inter-simple sequence repeat (ISSR) markers were conducted to detect S. ningpoensis from different origins. A 1 259-bp fragment amplified by primer UBC874 was found only in geo-authentic ones. By cloning and sequencing that specific band, sequence characterized amplified region (SCAR) markers were designed to distinguish geo-authentic S. ningpoensis from others. This is a rapid and easy method that can be used to identify the geographical authenticity of S. ningpoensis . Inter-simple sequence repeat (ISSR) Sequence characterized amplified region (SCAR) Scrophularia ningpoensis Chinese Materia Medica Traditional Chinese medicine Introduction 1 Scrophularia ningpoensis Hemsley, known as “Zhexuanshen”, used in the Chinese Materia Medica (CMM), belonging to the family Scrophulariaceae, has a long history of widespread use in China (Kajimoto et al., 1989 1989 ; Fernández et al., 1996 1996 ; Miyase and Mimatsu, 1999 1999 ; Giner et al., 2000 2000 ). S. ningpoensis named by Forbes and Hemsley ( 1890 1890 ) based on the specimens collected in Tiantong County, Ningbo City of Zhejiang Province, is endemic to China and now is widely cultivated in China as well. It is used to treat inflammation, laryngitis, tonsillitis, abscesses of carbuncles (Reid, 1996 1996 ), and constipation (Yen, 1992 1992 ). Recent research revealed that this medicinal species, which has high antiangiogenic activity, also can be used as an anticancer agent (Sagar et al., 2006 2006 ). The major bioactive components of S. ningpoensis have been reported to be harpagoside, angoroside C, acteoside, and cinnamic acid (Liu et al., 1995 1995 ; Miyazawa et al., 1998 1998 ; de Santos Galíndez et al., 2002 2002 ; Díaz et al., 2004 2004 ). However, determined by bioactive components, the quality and efficacy of CMM depend significantly on its geographical origin (Woo et al., 1999 1999 ). The chemical differences of Radix Scrophulariae among various production regions were demonstrated to different extents. That grown in Zhejiang Province has better medicinal effect and is recognized as geo-authentic (Wang and Wang, 2007 2007 ). Several methods based on high-performance liquid chromatography (HPLC) or combined with liquid chromatography-electrospray ionisation-mass spectrometry (LC-ESI-MS) were developed to quality and quantify the bioactive compounds in S. ningpoensis (Liu et al., 2007 2007 ; Zhu et al., 2008 2008 ). Our previous studies on HPLC fingerprints of S. ningpoensis have revealed that three of the four major bioactive compounds, harpagoside, angoroside C, and cinnamic acid, were largely variable among samples collected from different regions (Yang et al., 2010 2010 ). The materials from Zhejiang Province produced the highest contents of the bioactive compounds, which have the most anti-inflammatory effect (Yang et al., 2010 2010 ). Medicinal parts (roots) of S. ningpoensis originating from different geographical areas share similar morphological characters. Therefore, it is very difficult to distinguish S. ningpoensis of Zhejiang from others by using morphological methods. The quality control of CMM is important for safe and effective use (Chung et al., 2006 2006 ). Medicinal plants collected from different localities are considerably different in their therapeutic efficacy (Woo et al., 1999 1999 ). Recent developments in molecular biology techniques make DNA markers be useful for the identification and standardization of CMM (Yang et al., 2001 2001 ). Our group has established species-specific polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods for identifications of Actinidia macrosperma and Sinopodophyllum hexandrum (Gong et al., 2006 2006 ; Zhao et al., 2007 2007 ), and sequence characterized amplified region (SCAR) markers for Sinocalycanthus chinensis (Ye et al., 2006 2006 ). As to the identification of geo-authentic CMM, chemical fingerprints are the most used method, but the whole genome patterns are proven to be useful, accurate, and convenient as well. For instance, different arbitrarily primed (AP)-PCR fingerprints are used to distinguish samples of Astragalus membranaceus originated from different localities (Yip and Kwan, 2006 2006 ). For Codonopsis pilosula , AP-PCR and random amplification of polymorphic DNA (RAPD) fingerprints revealed different patterns according to different geographic origins (Zhang et al., 1999 1999 ). Similarly, Vitex rotundifolia samples from 14 different regions were divided by inter-simple sequence repeat (ISSR) markers (Hu et al., 2007 2007 ). In this study, we used ISSR method to detect the whole genome of S. ningpoensis from different geographical origins and found a specific fragment only in populations originated from Zhejiang Province. Then based on that specific fragment, we designed a pair of diagnostic primers to identify S. ningpoensis of Zhejiang Province. Materials and methods 1 Plant materials and DNA extraction 2 A total of 189 samples of S. ningpoensis originated from seven different Provinces were used in this study, wherein 85 individuals from three geographical origins were surveyed for ISSR and all samples were tested by designed SCAR primers (Table 1 1 ). The voucher specimens were deposited in the Herbarium of the Zhejiang University (HZU). DNA was isolated from silica-gel dried leaf by a modified hexadecyl trimethyl ammonium bromide (CTAB) method (Doyle, 1991 1991 ). Originated location Locality code Sample size ISSR Yaochuan, Pan’an County, Zhejiang YC 15 √ Renchuan, Pan’an County, Zhejiang RC 15 √ Guangmingcun, Pan’an County, Zhejiang GM 15 √ Shanghu, Pan’an County, Zhejiang PA 10 √ Xianju County, Zhejiang XJ 10 √ Hubei HB 10 √ Shanxi SX 10 √ Jinfo Mountain, Chongqing JF 19 Jingang Mountain, Jiangxi JX 15 Pingjiang County, Hunan HN 15 Jiuhua Mountain, Anhui AH 15 Tianmu Mountain, Zhejiang TM 15 Dapan Mountain, Zhejiang DP 10 Matou County, Jiangxi MT 15 ISSR-PCR amplification 2 Out of 100 ISSR markers (UBC primer set No. 9, Biotechnology Laboratory, University of British Columbia, Vancouver, Canada; http://www.ubc.ca/ http://www.ubc.ca/ ), twelve primers (Table 2 2 ) that produced the strongest, clearest, and most reproducible bands were selected for further study. A 25 μl PCR amplification run contained 25 ng of genomic DNA, 2.5 μl 10× buffer, 2 mmol/L MgCl 2 , 0.2 mmol/L dNTPs, 0.4 μmol/L of primers, and 2.0 U Taq DNA polymerase (Shanghai Sangon Biotechnology Co. Ltd., Shanghai, China). ISSR-PCR amplifications were performed in a GeneAmp® PCR System 9700 thermal cycler (Applied Biosystems, Foster City, USA) with programme: 94 °C for 4 min; 45 cycles of 94 °C for 30 s, 49.4–65.0 °C for 45 s, and 72 °C for 1.5 min; 72 °C for 10 min (the specific annealing temperature for every ISSR primer is in Table 2 2 ). For every PCR run, a negative control without template DNA was also included. And every PCR amplification was repeated at least twice. PCR products were electrophoresed on 1.5% (v/v) agarose gels along with DNA Marker DL2000 (TaKaRa Biotechnology Co. Ltd., Dalian, China), then stained with ethidium bromide (EB), visualized with ultraviolet, and photographed. Primer code Sequence (5′–3′) Annealing temp. (°C) UBC809 AGAGAGAGAGAGAGAGG 60.5 UBC810 GAGAGAGAGAGAGAT 53.0 UBC811 GAGAGAGAGAGAGAC 52.7 UBC812 GAGAGAGAGAGAGAA 50.8 UBC827 ACACACACACACACACG 60.5 UBC834 AGAGAGAGAGAGAGAGYT 49.4 UBC855 ACACACACACACACACYT 62.0 UBC859 TGTGTGTGTGTGTGTGRC 57.0 UBC874 CCCTCCCTCCCTCCCT 65.0 UBC881 GGGTGGGGTGGGGTG 60.5 UBC887 DVDTCTCTCTCTCTCTC 50.8 UBC889 DBDACACACACACACAC 50.8 Cloning and sequencing of ISSR marker fragment 2 The specific band only amplified in S. ningpoensis of Zhejiang Province was excised from 2% (v/v) agarose gels and purified DNA fragment was cloned using pUCm-T vector (Sangon, Shanghai, China). The GENECLEAN II kit (BIO 101 Inc., Carlsbad, USA) is used to purify DNA fragment. Sequencing was run on an ABI 3700 Sequencer (ABU, Italy) by Shanghai Sangon Biotechnology Co., Ltd. Sequences were edited by SEQUENCHER (Version 4.0.5 Gene Codes Corporation, Ann Arbor, MI, USA). Primer design and SCAR-PCR 2 Based on the sequencing results, a pair of primers (Table 3 3 ) was designed using the software of primer-primer 5.0 (Premier Biosoft International; Palo Alto, CA, USA) and synthesized by Shanghai Sangon Biotechnology Co., Ltd. The diagnostic PCR by primers CC874u and CC874d was carried out by programme: 94 °C for 5 min; 35 cycles of 94 °C for 30 s; 59 °C for 45 s; 72 °C for 1.5 min; 72 °C for 10 min. The reaction mixture is the same as ISSR-PCR, containing 0.2 μmol/L of the upper primer and 0.2 μmol/L of the lower primer. PCR products were run in 1.5% (v/v) agarose/EB gels. ISSR primer: UBC874; Annealing temperature: 59.0 °C SCAR primer Sequence (5′–3′) CC874u CTATCATCGTCTTTGTCCATCC CC874d TGCTTTGAAACATTTGAACTTG Results 1 Screening the specific ISSR marker 2 In this study, 85 individuals originated from three different provinces (Table 1 1 ) were surveyed by ISSR-PCR to develop SCAR markers. ISSR-PCR results show that primer UBC874 provided an approximately 1 300-bp band unique to populations originated from Zhejiang Province (Fig. 1 1 ). Arrow indicates the specific band, which is only in samples from Zhejiang Province. M: DNA marker. YC, RC, GM, XJ, PA, HB, and SX are locality codes as shown in Table 1 1 Conversion of ISSR marker to SCAR marker 2 This specific band amplified by ISSR primer UBC874 was only found in the genome of S. ningpoensis from Zhejiang Province, but not in the genome of others. After gel-purified, cloned and sequenced, this DNA fragment turned out to be 1 306 bp (GenBank accession No. EU082804.1; GI: 156185939). Based on analysis of that sequence, a pair of 22-bp SCAR primers (Table 3 3 ), CC874u and CC874d, was designed for the amplification of this DNA fragment. The upper primer was 70 bp from 5′ and the lower primer being 110 bp from 3′ amplified a 1 126 bp fragment from samples of Zhejiang Province. Testing designed SCAR primers 2 All samples listed in Table 1 1 were amplified by SCAR primers CC874u and CC874d to test their specificities. PCR products showed that a single band about 1 000 bp was only in accessions (Table 1 1 ) originated from Zhejiang Province (Fig. 2 2 ). Therefore, primers, CC874u and CC874d, designed in this study were proven to be diagnostic probe markers for identifying geo-authentic S . ningpoensis originated from Zhejiang Province. M: DNA marker. YC, RC, GM, PA, XJ, HB, SX, JF, JX, HN, AH, TM, DP, and MT are locality codes as shown in Table 1 1 Discussion 1 Nowadays, with the booming of the herbal medicine market, standardization of traditional Chinese medicine has become more and more important. CMM is different from western and chemical medicines. The multiple sources and geo-authenticity of CMM generate unique confusion, e.g., different herbs species sharing one name, one herb using different names, and even one species collected from different localities having different medical effects (Zhao et al., 2006 2006 ). S. ningpoensis has been widely used in CMM, but the geographical origin has always been a problem as mentioned above. Thus, to deal with the increasing dissatisfaction among consumers with the quality of herbal products and to obtain safe and effective application of CMM, an effective method to distinguish S. ningpoensis according to its geographical origins is critical (Moraes et al., 2005 2005 ). In general, morphological analysis, chemical chromatography, and DNA markers are used for authentication. Morphological method is conducted by observing, touching, smelling, and tasting (Zhao et al., 2006 2006 ). Although, it is fast and easy, it also largely depends on personal experience. In many cases, morphological characteristics are often variable, and may disappear when crude drugs only contain the medical part like roots of a whole plant. And some herbs from the same genus or family are difficult to identify because of the similar morphological characteristics. In this study, all samples are the same species, S. ningpoensis , collected from different localities. Thus, it is almost impossible to distinguish geo-authentic S. ningpoensis from others by morphological method. In recent years, chromatography has been widely used in the authentication of CMM (Hua et al., 2003 2003 ). In particular, the HPLC chromatography fingerprinting technique, which can provide more precise information, is used for the identification of geographical origins within the same species (Lu et al., 2005 2005 ). HPLC is not perfect, however, and needs large amounts of samples. And the result is always influenced by harvest time, storage period, and processing method of CMM, since the chemical gradients of plants are easily affected by those factors (Lum et al., 2005 2005 ). As to the process of HPLC experiments, standard chromatograms are first collected for a number of authentic species of samples. Then, four to nine characteristic peaks in a fingerprint chromatogram are chosen for authentication and identification purpose (Hu et al., 2005 2005 ). Thus, this method is considered to be complicated and time-consuming. In comparison to traditional and other existing methods, DNA markers have more advantages: sensitive, reliable, accurate, stable, convenient, and only a tiny amount of sample is sufficient. Among many types of DNA markers, for ISSR markers, no prior sequence reference is required, and they are more convenient than SSR and other markers (Zietkiewicz et al., 1994 1994 ). Because of the longer primers and higher annealing temperature, ISSR can provide more reproducibility and stability than RAPD markers (Camacho and Liston, 2001 2001 ). In addition, experiments of ISSR are much easier and less expensive than amplified fragment length polymorphism (AFLP) (Passinho-Soares et al., 2006 2006 ). Considering the high reproducibility and polymorphic nature, the simple process of experiments, the stability, and low cost, using ISSR markers for CMM authentication is more practical and reasonable. A pair of primers developed in this study is an extension of ISSR markers. Although ISSR markers have the potential to provide a rapid, reliable, and simple authentication, as a universal primer, the specificity of ISSR is not as good as species-specific molecular markers. Also, in many cases, it can be an advantage to amplify a single fragment (Techen et al., 2006 2006 ). This study provides a diagnostic PCR method to identify S. ningpoensis according to geographical origin by using species-specific molecular markers, and proves that DNA markers are much more useful for the identification of geographical origins than morphological and phytochemical methods. References FJ Camacho , A Liston . Population structure and genetics diversity of Botrychium pumicola (Ophioglossaceae) based on ISSR . Am J Bot , 2001 . 88 ( 6 ): 1065 - 1070 . 11410471 DOI: 10.2307/2657089 http://doi.org/10.2307/2657089 . Population structure and genetics diversity of Botrychium pumicola (Ophioglossaceae) based on ISSR SY Chung , FC Cheng , MS Lee , JY Lin , MC Lin , MF Wang . Ginkgo biloba leaf extract (EGb761) combined with neuroprotective agents reduces the infarct volumes of gerbil ischemic brain . Am J Chin Med , 2006 . 34 ( 5 ): 803 - 817 . 17080546 DOI: 10.1142/S0192415X06004302 http://doi.org/10.1142/S0192415X06004302 . Ginkgo biloba leaf extract (EGb761) combined with neuroprotective agents reduces the infarct volumes of gerbil ischemic brain J de Santos Galíndez , AMD Lanza , LF Matellano . Biologically active substances from the genus Scrophularia . Pharm Biol , 2002 . 40 ( 1 ): 45 - 59 . DOI: 10.1076/phbi.40.1.45.5864 http://doi.org/10.1076/phbi.40.1.45.5864 . Biologically active substances from the genus Scrophularia AM Díaz , MJ Abad , L Fernández , AM Silván , J de Santos , P Bermejo . Phenylpropanoid glycosides from Scrophularia scorodonia : in vitro anti-inflammatory activity . Life Sci , 2004 . 74 ( 20 ): 2515 - 2526 . DOI: 10.1016/j.lfs.2003.10.008 http://doi.org/10.1016/j.lfs.2003.10.008 . Phenylpropanoid glycosides from Scrophularia scorodonia: in vitro anti-inflammatory activity JJ Doyle . G Hewitt , A Johnston . DNA Protocols for Plants—CTAB Total DNA Isolation . Molecular Techniques in Taxonomy , 1991 . : Berlin, Germany Springer Verlag , 283 - 294 . . DNA Protocols for Plants—CTAB Total DNA Isolation MA Fernández , MD García , MT Sáenz . Antibacterial activity of the phenolic acids fraction of Scrophularia frutescens and Scrophularia sambucifolia . J Ethnopharmacol , 1996 . 53 ( 1 ): 11 - 14 . DOI: 10.1016/0378-8741(96)01419-5 http://doi.org/10.1016/0378-8741(96)01419-5 . Antibacterial activity of the phenolic acids fraction of Scrophularia frutescens and Scrophularia sambucifolia FB Forbes , WB Hemsley . An enumeration of all the plants known from China proper, Formosa, Hainan, Corea, the Luchu archipelago, and the island of Hongkong together with their distribution and synonymy . J Linn Soc Bot , 1890 . 26 ( 74 ): 178 - 179 . . An enumeration of all the plants known from China proper, Formosa, Hainan, Corea, the Luchu archipelago, and the island of Hongkong together with their distribution and synonymy RM Giner , ML Villalba , MC Recio , S Máñez , M Cerdá-Nicolás , JL Ríos . Anti-inflammatory glycoterpenoids from Scrophularia auriculata . Eur J Pharmacol , 2000 . 389 ( 2-3 ): 243 - 252 . 10688990 DOI: 10.1016/S0014-2999(99)00846-8 http://doi.org/10.1016/S0014-2999(99)00846-8 . Anti-inflammatory glycoterpenoids from Scrophularia auriculata W Gong , CX Fu , YP Luo , YX Qiu . Molecular identification of Sinopodophyllum hexandrum and Dysosma species using cpDNA sequences and PCR-RFLP markers . Planta Med , 2006 . 72 ( 7 ): 650 - 652 . 16673335 DOI: 10.1055/s-2006-931535 http://doi.org/10.1055/s-2006-931535 . Molecular identification of Sinopodophyllum hexandrum and Dysosma species using cpDNA sequences and PCR-RFLP markers P Hu , GA Luo , ZZ Zhao , ZH Jiang . Multi-component HPLC fingerprinting of Radix Salviae Miltiorrhizae and its LC-MS-MS identification . Chem Pharm Bull (Tokyo) , 2005 . 53 ( 6 ): 677 - 683 . 15930782 DOI: 10.1248/cpb.53.677 http://doi.org/10.1248/cpb.53.677 . Multi-component HPLC fingerprinting of Radix Salviae Miltiorrhizae and its LC-MS-MS identification Y Hu , Q Zhang , H Xin , LP Qin , BR Lu , K Rahman . Association between chemical and genetic variation of Vitex rotundifolia populations from different locations in China: its implication for quality control of medicinal plants . Biomed Chromatogr , 2007 . 21 ( 9 ): 967 - 975 . 17474140 DOI: 10.1002/bmc.841 http://doi.org/10.1002/bmc.841 . Association between chemical and genetic variation of Vitex rotundifolia populations from different locations in China: its implication for quality control of medicinal plants R Hua , SQ Sun , Q Zhou , I Noda , BQ Wang . Discrimination of fritillary according to geographical origin with Fourier transform infrared spectroscopy and two-dimensional correlation IR spectroscopy . J Pharmaceut Biomed , 2003 . 33 ( 2 ): 199 - 209 . DOI: 10.1016/S0731-7085(03)00253-X http://doi.org/10.1016/S0731-7085(03)00253-X . Discrimination of fritillary according to geographical origin with Fourier transform infrared spectroscopy and two-dimensional correlation IR spectroscopy T Kajimoto , M Hidaka , K Shoyama , T Nohara . Iridoids from Scrophularia ninpoensis . Phytochemistry , 1989 . 28 ( 10 ): 2701 - 2704 . DOI: 10.1016/S0031-9422(00)98071-3 http://doi.org/10.1016/S0031-9422(00)98071-3 . Iridoids from Scrophularia ninpoensis CW Liu , ZM Bi , YF Zhu , P Li . Simultaneous determination of four kinds of bioactive components in Radix Scrophulariae by HPLC . China Pharm J , 2007 . 42 ( 21 ): 1614 - 1616 . (in Chinese) . Simultaneous determination of four kinds of bioactive components in Radix Scrophulariae by HPLC L Liu , WR Hudgins , S Shack , MQ Yin , D Samid . Cinnamic acid: a natural product with potential use in cancer intervention . Int J Cancer , 1995 . 62 ( 3 ): 345 - 350 . 7628877 DOI: 10.1002/ijc.2910620319 http://doi.org/10.1002/ijc.2910620319 . Cinnamic acid: a natural product with potential use in cancer intervention GH Lu , K Chan , YZ Liang , KSY Leung , CL Chan , ZH Jiang . Development of high performance liquid chromatographic fingerprints for distinguishing of Chinese Angelica from related umbelliferae herbs . J Chromatogr A , 2005 . 1073 ( 1-2 ): 383 - 392 . 15909545 DOI: 10.1016/j.chroma.2004.11.080 http://doi.org/10.1016/j.chroma.2004.11.080 . Development of high performance liquid chromatographic fingerprints for distinguishing of Chinese Angelica from related umbelliferae herbs RM Lum , E Potter , T Dang , D Heber , M Hardy , MA Hirsch . Identification of botanicals and potential contaminants through RFLP and sequencing . Planta Med , 2005 . 71 ( 9 ): 841 - 846 . 16206039 DOI: 10.1055/s-2005-871230 http://doi.org/10.1055/s-2005-871230 . Identification of botanicals and potential contaminants through RFLP and sequencing T Miyase , A Mimatsu . Acylated iridoid andphenylethanoid glysocides from the aerial parts of Scrophularia nodosa . J Nat Prod , 1999 . 62 ( 8 ): 1079 - 1084 . 10479307 DOI: 10.1021/np9805746 http://doi.org/10.1021/np9805746 . Acylated iridoid andphenylethanoid glysocides from the aerial parts of Scrophularia nodosa M Miyazawa , Y Okuno , S Nakamura , H Kameoka . Suppression of SOS-inducing activity of chemical mutagens by cinnamic acid derivatives from Scrophulia ningpoensis in the Salmonella typhimurium TA1535/pSK1002 umu test . J Agric Food Chem , 1998 . 46 ( 3 ): 904 - 910 . DOI: 10.1021/jf9704221 http://doi.org/10.1021/jf9704221 . Suppression of SOS-inducing activity of chemical mutagens by cinnamic acid derivatives from Scrophulia ningpoensis in the Salmonella typhimurium TA1535/pSK1002 umu test RM Moraes , HG Momm , B Silva , V Maddox , GL Easson , H Lata , D Ferreira . Geographic information system method for assessing chemo-diversity in Medicinal plants . Planta Med , 2005 . 71 ( 12 ): 1157 - 1164 . 16395654 DOI: 10.1055/s-2005-873166 http://doi.org/10.1055/s-2005-873166 . Geographic information system method for assessing chemo-diversity in Medicinal plants H Passinho-Soares , D Felix , MA Maria Auxiliadora Kaplan , M Margis-Pinheiro , R Margis . Authentication of medicinal plant botanical identity by amplified fragmented length polymorphism dominant DNA marker: inferences from the Plectranthus genus . Planta Med , 2006 . 72 ( 10 ): 929 - 931 . 16791770 DOI: 10.1055/s-2006-946673 http://doi.org/10.1055/s-2006-946673 . Authentication of medicinal plant botanical identity by amplified fragmented length polymorphism dominant DNA marker: inferences from the Plectranthus genus DP Reid . Chinese Herbal Medicine , 1996 . : Boston, US Shambhala Publications Inc. Press , 98 . Chinese Herbal Medicine SM Sagar , D Yance , RK Wong . Natural health products that inhibit angiogenesis: a potential source for investigational new agents to treat cancer—Part 1 . Curr Oncol , 2006 . 13 ( 1 ): 14 - 26 . 17576437 . Natural health products that inhibit angiogenesis: a potential source for investigational new agents to treat cancer—Part 1 N Techen , IA Khan , ZQ Pan , BE Scheffler . The use of polymerase chain reaction (PCR) for the identification of Ephedra DNA in dietary supplements . Planta Med , 2006 . 72 ( 3 ): 241 - 247 . 16534729 DOI: 10.1055/s-2005-916173 http://doi.org/10.1055/s-2005-916173 . The use of polymerase chain reaction (PCR) for the identification of Ephedra DNA in dietary supplements JK Wang , JL Wang . History and Genuine Character of Traditional Chinese Medicine , 2007 . : Beijing, China Science and Technology of China Medicine Press , 94 (in Chinese) . History and Genuine Character of Traditional Chinese Medicine YA Woo , HJ Kim , J Cho , H Chung . Discrimination of herbal medicines according to geographical origin with near infrared reflectance spectroscopy and pattern recognition techniques . J Pharmaceut Biomed Anal , 1999 . 21 ( 2 ): 407 - 413 . DOI: 10.1016/S0731-7085(99)00145-4 http://doi.org/10.1016/S0731-7085(99)00145-4 . Discrimination of herbal medicines according to geographical origin with near infrared reflectance spectroscopy and pattern recognition techniques M Yang , DM Zhang , JQ Liu , JH Zheng . A molecular marker that is specific to medicinal rhubarb based on chloroplast trnL/trnF sequences . Planta Med , 2001 . 67 ( 8 ): 784 - 786 . 11731933 DOI: 10.1055/s-2001-18341 http://doi.org/10.1055/s-2001-18341 . A molecular marker that is specific to medicinal rhubarb based on chloroplast trnL/trnF sequences S Yang , C Chen , Y Zhao , W Xi , X Zhou , B Chen , C Fu . Association between chemical and genetic variation of wild and cultivated populations of Scrophularia ningpoensis Hemsl . Planta Med , 2010 . in press . Association between chemical and genetic variation of wild and cultivated populations of Scrophularia ningpoensis Hemsl Q Ye , YX Qiu , YQ Quo , JX Chen , SZ Yang , MS Zhao , CX Fu . Species-specific SCAR markers for authentication of Sinocalycanthus chinensis . J Zhejiang Univ-Sci B , 2006 . 7 ( 11 ): 868 - 872 . 17048299 DOI: 10.1631/jzus.2006.B0868 http://doi.org/10.1631/jzus.2006.B0868 . Species-specific SCAR markers for authentication of Sinocalycanthus chinensis KY Yen . The Illustrated Chinese Materia Medica Crude and Prepared , 1992 . : Taiwan, China SMC Publishing Inc. Press , 64 (in Chinese) . The Illustrated Chinese Materia Medica Crude and Prepared PY Yip , HS Kwan . Molecular identification of Astragalus membranaceus at the species and locality levels . J Ethnopharmacol , 2006 . 106 ( 2 ): 222 - 229 . 16442761 DOI: 10.1016/j.jep.2005.12.033 http://doi.org/10.1016/j.jep.2005.12.033 . Molecular identification of Astragalus membranaceus at the species and locality levels YB Zhang , FN Ngan , ZT Wang , TB Ng , PP But , PC Shaw . Random primed polymerase chain reaction differentiates Codonopsis pilosula from different localities . Planta Med , 1999 . 65 ( 2 ): 157 - 160 . 17260247 DOI: 10.1055/s-1999-14058 http://doi.org/10.1055/s-1999-14058 . Random primed polymerase chain reaction differentiates Codonopsis pilosula from different localities YP Zhao , YX Qiu , W Gong , CX Fu , JH Li . Authentication of Actinidia macrosperma using PCR-RFLP based on trn K sequences . Botanical Studies , 2007 . 48 ( 3 ): 239 - 242 . . Authentication of Actinidia macrosperma using PCR-RFLP based on trnK sequences ZZ Zhao , Y Hu , ZT Liang , JP Yuen , ZH Jiang , KS Leung . Authentication is fundamental for standardization of Chinese Medicines . Planta Med , 2006 . 72 ( 10 ): 865 - 874 . 16902852 DOI: 10.1055/s-2006-947209 http://doi.org/10.1055/s-2006-947209 . Authentication is fundamental for standardization of Chinese Medicines YF Zhu , ZM Bi , CW Liu , MT Ren , FH Wu , P Li . Endothelial cell extraction and HPLC-ESI/TOF MS analysis for predicting potential bioactive components of Radix Scrophulariae . J China Pharm Univ , 2008 . 39 228 - 231 . (in Chinese) . Endothelial cell extraction and HPLC-ESI/TOF MS analysis for predicting potential bioactive components of Radix Scrophulariae E Zietkiewicz , A Rafalski , D Labuda . Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification . Genomics , 1994 . 20 ( 2 ): 176 - 183 . 8020964 DOI: 10.1006/geno.1994.1151 http://doi.org/10.1006/geno.1994.1151 . Genome fingerprinting by simple sequence repeat (SSR)-anchored polymerase chain reaction amplification The authors thank Mr. Shu-qing SUN (Zhejiang University, China) and Mr. Ming-shui ZHAO (Tianmu Natural Reserve Institute, Zhejiang, China) for collecting samples during fieldwork. 10.1631/jzus.B1000179 Project supported by the National Basic Research Program (973) of China (No. 2007CB411600), the National Natural Science Foundation of China (No. 31070205), and the Key Agricultural Program of Pan’an County of Zhejiang Province, China (No. 2005ZB01) 2010-05-16 2011-04-12 2010-11-15 2022-01-05 Copyright © Zhejiang University and Springer-Verlag Berlin Heidelberg 2011 2011 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 05 12