Differentiation of smooth muscle progenitor cells in peripheral blood and its application in tissue engineered blood vessels

Differentiation of smooth muscle progenitor cells in peripheral blood and its application in tissue engineered blood vessels 1 first-author 1 1 2 2 1 1 1 corresp ‡Corresponding Author ‡Corresponding Author †E-mail:lfpan@shmu.edu.cn †E-mail:lfpan@shmu.edu.cn lfpan@shmu.edu.cn Laboratory of Molecular Biology, Shanghai Medical College, Fudan University, Shanghai 200032, China Laboratory of Molecular Biology, Shanghai Medical College, Fudan University, Shanghai 200032, China Key Laboratory of Molecular Engineering of Polymers, Ministry of Education, Department of Macromolecular Science, Fudan University, Shanghai 200433, China Key Laboratory of Molecular Engineering of Polymers, Ministry of Education, Department of Macromolecular Science, Fudan University, Shanghai 200433, China Background: 2 A major shortcoming in tissue engineered blood vessels (TEBVs) is the lack of healthy and easily attainable smooth muscle cells (SMCs). Smooth muscle progenitor cells (SPCs), especially from peripheral blood, may offer an alternative cell source for tissue engineering involving a less invasive harvesting technique. Methods: 2 SPCs were isolated from 5-ml fresh rat peripheral blood by density-gradient centrifugation and cultured for 3 weeks in endothelial growth medium-2-MV (EGM-2-MV) medium containing platelet-derived growth factor-BB (PDGF BB). Before seeded on the synthesized scaffold, SPC-derived smooth muscle outgrowth cell (SOC) phenotypes were assessed by immuno-fluorescent staining, Western blot analysis, and reverse transcription polymerase chain reaction (RT-PCR). The cells were seeded onto the silk fibroin-modified poly(3-hydroxybutyrate- co -3-hydroxyhexanoate) (SF-PHBHH x ) scaffolds by 6×10 4 cells/cm 2 and cultured under the static condition for 3 weeks. The growth and proliferation of the seeded cells on the scaffold were analyzed by 3-(4,5-dimethylthiazol-2-yl)-diphenyltetrazolium bromide (MTT) assay, scanning electron microscope (SEM), and 4,6-diamidino-2-phenylindole (DAPI) staining. Results: 2 SOCs displayed specific “hill and valley” morphology, expressed the specific markers of the SMC lineage: smooth muscle (SM) α-actin, calponin and smooth muscle myosin heavy chain (SM MHC) at protein and messenger ribonucleic acid (mRNA) levels. RT-PCR results demonstrate that SOCs also expressed smooth muscle protein 22α (SM22α), a contractile protein, and extracellular matrix components elastin and matrix Gla protein (MGP), as well as vascular endothelial growth factor (VEGF). After seeded on the SF-PHBHH x scaffold, the cells showed excellent metabolic activity and proliferation. Conclusion: 2 SPCs isolated from peripheral blood can be differentiated into the SMCs in vitro and have an impressive growth potential in the biodegradable synthesized scaffold. Thus, SPCs may be a promising cell source for constructing TEBVs. Smooth muscle progenitor cells (SPCs) Tissue-engineered blood vessels (TEBVs) Silk fibroin (SF) Poly(3-hydroxybutyrate- co -3-hydroxyhexanoate) (PHBHH x ) INTRODUCTION 1 Blood vessel replacements are frequently necessary in the treatment of advanced atherosclerosis, vascular trauma, aneurysmal and peripheral vascular diseases. The autologous saphenous veins and mammary arteries are currently the preferred graft materials. However, the availability of the appropriate dimensional tissues is limited, and donor site morbidity is a significant complication in these procedures. The emerging and interdisciplinary field of tissue engineering has evolved to represent a potential means to construct functional grafts that could be used in vascular replacement procedures where autologous tissue is unavailable and synthetic materials fail (Nugent and Edelman, 2003 2003 ). To construct tissue engineered blood vessels (TEBVs), the key processes are to obtain seeding cells, culture them, and plant them in scaffolds. Despite the significant progress toward the development of biomaterials and methods to cultivate three-dimensional (3D) vascular constructs, cell sourcing remains a major problem. Blood vessels are mainly composed of endothelial cells (ECs) and smooth muscle cells (SMCs), fibroblasts, and pericytes. SMCs help to maintain the contraction function of blood vessels, adjust blood distribution, and secrete extracellular matrix (ECM) and angiogenic factors (Wu et al., 2004 2004 ). SMCs used in TEBVs largely come from mature blood vessels. However, the limited proliferation ability of mature SMCs, traumatic obtaining processes and even deficiency of healthy blood vessels impede the application of SMCs in TEBVs. Therefore, an autologous source of SMCs with high proliferative capacity is necessary for preparation of TEBVs. Adult stem cells from peripheral blood provide a promising alternative as they are easy to be obtained and they show an extensive in vitro proliferation capacity. Moreover, adult stem cells are not compounded by the ethical considerations of embryonic stem cells and they are readily available for research (Wu et al., 2006 2006 ). Former researches proved that endothelial progenitor cells (EPCs) have the capacity to resemble those of mature ECs in TEBVs construction (Kaushal et al., 2001 2001 ; Melero-Martin et al., 2007 2007 ; Fang et al., 2007 2007 ). However, there are much fewer reports about the application of smooth muscle progenitor cells (SPCs) in TEBVs. Liu et al.( 2007 2007 ) selected a proliferative cell population that displayed morphologic and biochemical characteristics of SMCs from bone marrow by using an SM α-actin promoter and fluorescence activated cell sorting. However, acquiring bone marrow would cause pain and discomfort and the method was quite complicated. Simper et al.( 2002 2002 ) demonstrated smooth muscle outgrowth cells (SOCs) with a specific growth, adhesion, and migration profile from putative SPCs in human peripheral blood. Later research indicated that the adult peripheral blood CD34 + cells can be differentiated into cardiomyocytes, mature ECs, and SMCs in vivo (Yeh et al., 2003 2003 ). Collectively, these studies suggested that there are SPCs in peripheral blood. Therefore, we try to isolate SPCs among mononuclear cells from rat peripheral blood, allow them to differentiate into SOCs, and test whether SOCs can replace mature SMCs as a new source of TEBVs seeding cells. The differentiated SOCs were seeded on the synthesized scaffold. Synthetic polymers have been commonly used as the scaffolds to support cell growth and provide the mechanical support necessary for the implantation. Recently, poly(3-hydroxybutyrate- co -3-hydroxyhexanoate) (PHBHH x ) is applied as a novel biodegradable material for tissue engineering scaffold; it has been demonstrated to be non-thrombogenic, significantly reducing the potential for hyperplasia and thrombosis that have plagued many other TEBVs materials. Our former studies also suggested that surface modification with silk fibroin (SF), a natural protein regenerated from silkworm silk fiber, would be an effective way to enhance the cell adhesion and improve the biocompatibility of synthesized scaffold, facilitating its application in practical tissue engineering (Chen et al., 2004 2004 ). Thus we apply the SF-modified PHBHH x (SF-PHBHH x ) scaffold to assess SOCs’ potential as seeding cells in TEBVs. MATERIALS AND METHODS 1 Preparation and differentiation of peripheral blood mononuclear cells (PBMCs) 2 PBMCs were isolated from a volume of 5 ml heparinized rat peripheral blood. The blood was diluted 1:2 with sterilized phosphate buffered saline (PBS). PBMCs were then separated by density-gradient centrifugation using HISTOPAQUE-1083 (Sigma, St. Louis, MO, USA). After washed twice in PBS, PBMCs were then resuspended in endothelial growth medium-2-MV (EGM-2-MV) medium (Cambrex-Clonetics, Walkersville, MD, USA) containing 50 ng/ml platelet-derived growth factor-BB (PDGF BB) (R & D Systems Inc., Minneapolis, MN, USA), and then placed on 2 wells of a 6-well plate. After PBMCs were differentiated to SOCs, the cells were cultured in M199 (Gibco-BRL, Grand Island, NY, USA) supplemented with 10% (w/v) fetal bovine serum (Hyclone, USA), 100 U/ml penicillin (Sigma), 100 mg/ml streptomycin (Sigma), 10 ng/ml basic fibroblast growth factor (bFGF) (Sigma) and 4 mmol/L L-glutamine (Sigma). Cultures were incubated at 37 °C in a humidified atmosphere of 5% (v/v) CO 2 in air. The preparation and differentiation of PBMCs were repeated at least five times using different rats. Immunofluorescent analysis 2 The cells on glass cover slips were washed twice with PBS at room temperature, fixed with 4% (w/v) formaldehyde, penetrated with 0.2% (v/v) TritonX-100, and blocked with 10% (v/v) normal goat serum. The cells were incubated with the following antibodies: monoclonal mouse anti smooth muscle (SM) α-actin (1:250 dilution, Sigma), monoclonal mouse antibody to smooth muscle myosin heavy chain (SM MHC) (NeoMarkers, Fremont, CA, USA), calponin (1:250 dilution, NeoMarkers) for 1 h at room temperature. Rhodamine labeled anti-mouse antibodies (Miles Scientific, Naperville, IL, USA) were used as a secondary antibody. Cell nuclei were counterstained with 0.5 μg/ml 4,6-diamidino-2-phenylindole (DAPI) (Sigma). The immunostained cells were examined under a fluorescent microscope (Olympus BX-50, Japan). PBMCs were used as a negative control for the SMC-specific markers. Western blot analysis 2 The cells were washed in PBS and lysed in a buffer containing 50 mmol/L Tris-HCl (pH 8.0), 150 mmol/L NaCl, 0.02% (w/v) sodium azide, 0.1% (w/v) sodium dodecyl sulfate (SDS), 100 μg/ml phenylmethylsulphonyl fluoride (PMSF), and 1 μg/ml aprotinin. After incubation on ice for 30 min, the lysates were subjected to centrifugation at 12000× g for 10 min at 4 °C. The supernatants were collected after the centrifugation. After separated on 10% (w/v) denaturing sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes by electroblotting, the membrane was incubated with 5% (w/v) nonfat dry milk at 4 °C overnight to block nonspecific antibody binding. Then the membrane was immunoblotted using monoclonal antibodies to SM α-actin, calponin, and SM MHC at dilutions of 1:500. Secondary alkaline phosphatase conjugated affinipure goat anti-mouse IgG (H+L) (Jackson ImmunoResearch, West Grove, PA, USA) at a 1:1000 dilution were used for detection using Luminescent Detection Kit (Roche Molecular Biochemicals, Indianapolis, IN, USA) and X-ray film exposure (Kodak, Rochester, NY, USA). Mature human SMCs (hSMCs) and PBMCs were used as positive and negative control cells for smooth muscle-specific markers, respectively. Reverse transcription polymerase chain reaction (RT-PCR) analysis 2 The messenger ribonucleic acid (mRNA) levels of rat glyceraldehyde-3-phosphate dehydrogenase (GAPDH), rat SM α-actin, rat calponin, rat smooth muscle protein 22α (SM22α), rat SM MHC, rat elastin, rat matrix Gla protein (MGP) and rat vascular endothelial growth factor (VEGF) from SOCs and PBMCs were analyzed by RT-PCR analysis. Total RNA from PBMCs and SOCs was isolated by TriZol (Molecular Research Center, Cincinnati, OH, USA) and RT-PCR was performed using RT-PCR Kit (Promega, Madison, WI, USA) according to the manufacturer’s protocol: the complementary DNA (cDNA) was synthesized from 1 μg of total RNA using oligo(dT) 15 as a primer and moloney murine leukemia virus (M-MLV) reverse transcriptase. The sequences of sense and anti-sense primers and the experimental conditions are given in Table 1 1 . The reaction was carried out for 30 cycles with the following steps: denaturation for 30 s at 94 °C, annealing for 30 s and extension for 90 s at 72 °C. Each PCR reaction included a sample in which H 2 O was used as template (negative control). Gene Sense primer (5′ to 3′) Anti-sense primer (5′ to 3′) Annealing temp. (°C) Expected size (bp) SM α-actin GATCACCATCGGGAATGAACGC CTTAGAAGCATTTGCGGTGGAC 60 389 Calponin TAGAGCTTGCAGATGGGGAGCAA TGGGAAAGCTCCAGGGATGA 60 339 SM22α GCCGTGAAGTGCAGTCCAAG TCCCTCTTATGCTCCTGGGC 62 454 SM MHC ATCGCCCAGCTGGAGGAGGAG TCATCCTCCACCTGCAG 60 371 Elastin AACGAGCTGTTCCAAGCCTA CTGGAGACCCACCAACTTGT 60 126 MGP CCTGTGCTATGAATCTCACGA GCAACGAACACGAATCTGTG 60 351 VEGF CTGCTCTCTTGGGTGCACTGG CACCGCCTTGGCTTGTCACAT 62 431, 563, 635 GAPDH ATGGGTGTGAACCACGAGAA GGCATGGACTGTGGTCATGA 60 144 The PCR products were visualized by ethidium bromide staining following electrophoresis on 1.2% (w/v) agarose gel. Each PCR reaction was conducted at least twice with RNA from two independent experiments. Seeding of SOCs on SF-PHBHH x matrices 2 The porous PHBHH x film was prepared by solvent-casting and particle-pulling off as described by Mei et al.( 2006 2006 ). The scaffold was made into a round porous membrane (0.4 mm thick and 15 mm in diameter). Then PHBHH x film was immersed into SF solution for 24 h to form the SF-coated scaffold, freeze-dried, and fixed by methanol. The sheets were sterilized with 75% (v/v) ethanol overnight and then by ultraviolet light for 2 h. The sterilized matrices were pre-incubated in PBS solution to replace the ethanol remaining in the samples and then were transferred to a sterile 24-well cell culture plate. The SOCs were digested with 0.25% (w/v) trypsin (Sigma) and resuspended to be 1×10 6 cells/ml. Then 100 μl cell suspension was dripped into each matrix. After the cells were cultured in a humidified incubator (5% (v/v) CO 2 , 37 °C) for 1 h, additional 1 ml culture medium was added into each well. The culture medium was replenished every 2 d. MTT [3-(4,5-dimethylthiazol-2-yl)-diphenyltetrazolium bromide] assay 2 Cell numbers of viable SOCs in the SF-PHBHH x matrices were quantitatively assessed with MTT (Sigma) at various cultural time courses up to 21 d. The cell-contained matrices were rinsed with the serum free medium to remove the unattached dead cells, transferred to another cell culture plate, and incubated with 100 μl MTT stock solution (0.5 mg/ml in M199) for 4 h at 37 °C. The formed MTT formazan was then dissolved into 300 μl/well dimethyl sulfoxide (DMSO). Optical density (OD) of the MTT formazan in DMSO solution was measured with an automatic microplate reader (ELX 800, Bio-Tek, USA) at the wavelength of 565 nm ( OD 565 ) referred to the value at 630 nm. Both DMSO and the matrices without cells cultured were assayed as the background. Four parallel samples were measured each time. Cell morphology 2 After cells in the SF-PHBHH x matrices were cultured for different days, the cell-contained SF-PHBHH x matrices were washed with PBS three times, and then SOCs were fixed with 5% (w/v) glutaraldehyde (Sigma) in PBS for 24 h at 4 °C. The matrices were dehydrated sequentially in 50%, 70%, 90%, and 100% (v/v) ethanol, each for 15 min, and then freeze-dried, sputter-coated with gold, and examined by a scanning electron microscope (SEM). To observe SOCs’ distribution in the internal section of the scaffolds, the scaffolds were stained with 0.5 mg/L DAPI for 10 min and the sections were frozen and statically observed by immunostaining. Statistical analysis 2 The data represent mean± SD of four replicates. Statistical relevance was assessed by using the t -test through Excel. P < 0.05 was considered significant. RESULTS 1 SPCs’ differentiation and proliferation 2 Approximately 30% of the freshly isolated PBMCs adhered to culture plates and parts of them showed “polarity” after 3 d of culture with PDGF BB-containing EGM-2-MV medium (Fig. 1a 1a ). The cells elongated further toward a spindle-shaped morphology 1 week later (Fig. 1b 1b ). More and more long-and-narrow cells appeared and trended to form clusters after 2 weeks (Fig. 1c 1c ). Three weeks after isolation, some outgrowth cells displayed specific morphological characteristics of typical mature SMCs observed through phase contrast microscope (Fig. 1d 1d ). Some cells showed myofilament (Fig. 1e 1e ). Hereafter, many colonies with “hill and valley” morphology showed impressive growth potential, i.e., the cells could be sub-cultured repeatedly with no apparent loss of the proliferative potential even after 30 passages (Fig. 1f 1f ). Immunophenotyping of smooth muscle outgrowth cells 2 After three weeks of culture, the SOCs were characterized by the immunofluorescent staining using antibodies specific to smooth muscle cell markers. More than 95% SOCs differentiated from PBMCs were stained positively for SM α-actin, calponin and SM MHC, whereas the starting PBMCs population stained negatively for all smooth muscle cell markers (Fig. 2 2 ). To further evaluate the phenotype and function of the cultured SOCs population, the cell lysates from SOCs, hSMCs, and PBMCs were examined by Western blot. The results show that the expression pattern of the markers changed toward a more mature SMC phenotype after four-week culture in PDGF BB-containing EGM-2-MV medium as seen by a significant expression of mature SMC-specific markers, including SM α-actin (42 kD), calponin (34 and 29 kD), SM MHC (200 kD). The levels of these three proteins in SOCs were parallel to those in mature hSMCs. However, PBMCs did not express SM α-actin, calponin, or SM MHC (Fig. 3 3 ). Expression levels of smooth muscle markers and function molecules by mRNA examination 2 The expression of SM α-actin, calponin, and SM MHC was analyzed by mRNA level as well (Fig. 4 4 ). In addition, the expression of smooth muscle cell function genes including SM22α, MGP, elastin, and VEGF was also analyzed. The experiments demonstrated that SOCs highly expressed SM α-actin (389 bp), calponin (339 bp), SM MHC (371 bp), and SM22α (454 bp), whose proteins hold contraction function. The SOCs also significantly express extracellular matrix components: elastin (126 bp) and MGP (351 bp), as well as VEGF (three major forms: VEGF120, 431 bp; VEGF164, 563 bp; VEGF188, 635 bp), while fresh PBMCs did not express these specific genes (data not shown). Cellular proliferation in the scaffolds 2 Because of the linear correlation between the viable cell number and the optical density of MTT formazan (Zund et al., 1999 1999 ), the OD 565 values of MTT formazan in the SF-PHBHH x hybrid scaffold (Fig. 5 5 ) indicated that SOCs in the SF-PHBHH x hybrid scaffold kept a good growing from Day 3 to Day 21. The cellular proliferation in SF-PHBHH x hybrid scaffold was significantly higher than that in PHBHH x scaffold ( P < 0.05) (data not shown). Adhesion and growth of SOCs by SEM observation and DAPI staining 2 Three days after seeded on the SF-PHBHH x hybrid scaffold, SOCs adhered to the surface of the scaffold with filopodia (Fig. 6a 6a ). The cells attached well to the scaffold and began to aggregate after one-week culture (Fig. 6b 6b ). Three weeks later, SOCs spread through the pores, formed the confluent lamellar structure and grew into the deeper section of scaffolds (Figs. 6c and 6d 6c and 6d ). DAPI staining showed that 90% of scaffolds were evenly occupied by SOCs after one-week culture, which was in accordance with the observation by SEM, and that SOCs grew into the deeper pores of the scaffolds (Fig. 6e 6e ). DISCUSSION 1 Lack of availability of autologous vascular grafts and the pain and discomfort associated with the donor site necessitate the development of TEBVs for tissue regeneration. Because TEBVs are expected to have the potential to grow, self-repair, and self-remodel, they should contain living donor cells (Campbell and Campbell, 2007 2007 ). SPCs are autologous and readily available, and exhibit a high proliferative potential in vitro, share a low potential for tumor genesis, and thus could serve as promising donor cells. To date, characterization of SMCs often is done by demonstrating the presence of SM α-actin, which is also expressed by myofibroblasts and ECs under certain conditions, and hence not alone to SMCs. SM22α and calponin are increasingly SMCs restrictive, but transient expression in non-SMCs cannot be ruled out. Expression of SM MHC has been extensively scrutinized by many different laboratories, and seems to be highly restricted to SMCs (Sartore et al., 1994 1994 ; Regan et al., 2000 2000 ). Of particular note, Miano et al.( 1994 1994 ) carried out very detailed in situ hybridization analyses of expression of SM MHC throughout the development and maturation of whole mouse embryos, and found no evidence for the expression of this marker in cell types other than SMCs. Together, these SMC-restricted genes provide a template for phenotypic characterization (Owens et al., 2004 2004 ; Liu et al., 2008 2008 ). Phenotypically, SMCs differ from cardiac and skeletal muscle cells not only by their expression of specific contractile proteins, but also by their plasticity or ability to reenter the cell cycle and exhibit a “synthetic” phenotype, secreting ECM proteins (Mahoney and Schwartz, 2005 2005 ; Stegemann et al., 2005 2005 ). RT-PCR showed that the SOCs highly expressed elastin, MGP and VEGF at mRNA level. The outcome proteins of these mRNAs consist of the components of extracellular matrix in blood vessels. A lack of organized extracellular elastin would result in lower compliances of engineered vessels (Dahl et al., 2007 2007 ; Gao et al., 2008 2008 ). MGP, a vitamin K-dependent protein and a major calcification inhibitory factor, plays an important role in performing unique vascular wall biomechanical properties (Shanahan et al., 1998 1998 ; Schurgers et al., 2005 2005 ). VEGF appears to be a strong stimulator of new vessel growth in adults (Gao et al., 2001 2001 ). In our study, SOCs displayed morphological and phenotypic properties of SMC as shown by expression of smooth muscle markers—SM α-actin, calponin, SM MHC, SM22α, elastin, MGP, and VEGF. Notably, SOCs displayed contractile and synthetic properties, suggesting that these cells had developed a functional SMC phenotype for constructing blood vessels. Our study proves that the cells cultured in PDGF BB-enriched medium caused rapid outgrowth and expansion of SOCs to more than 30 population doublings in a 3-month period with no apparent loss of proliferative potential. In contrast to adult hSMCs that became senescent after approximately 10 population doublings, SPCs have a much higher proliferation potential. Another important advantage of using SOCs derived from mononuclear cells for TEBVs is that the cells can be obtained from peripheral blood, i.e., from a newborn’s own cord blood that may be stored for later use, or from juvenile or adult peripheral blood. The use of cells from peripheral blood eliminates the need to sacrifice a blood vessel or tissue to obtain SMCs (Jevon et al., 2008 2008 ). Our study shows that the activity and proliferation of SOCs on PHBHH x scaffold were improved greatly in a 3-week-culture period, greater than those of SMCs in the same experiment condition (data not shown). Meanwhile, we also proved that SF-PHBHH x scaffold is more suitable for SOCs growth compared with PHBHH x scaffold (data not shown), which is consistent with Mei et al.( 2006 2006 )’s and Zhang et al.( 2008 2008 )’s work. Although a serious limitation thus far for a therapeutic application of postnatal SPCs is their low number in the human circulation, this should not be an impediment, since the improvements in the cell purification and culture methods have been rapid in recent years. In addition, approaches to overcome this problem also include the mobilization of PBMCs in vivo by use of growth factors. Especially, granulocyte colony-stimulating factor mobilized PBMCs (G-PBMCs) has been widely used in clinical therapy (Bensinger et al., 1993 1993 ; Pettengell et al., 1993 1993 ). However, further studies are necessary for understanding the physiologic function of SPCs and the factors that determine their number and turnover rate, as well as the mechanisms that stimulate or inhibit their differentiation in vitro and in vivo. W Bensinger , J Singer , F Appelbaum , K Lilleby , K Longin , S Rowley , E Clarke , R Clift , J Hansen , T Shields , 等 . Autologous transplantation with peripheral blood mononuclear cells collected after administration of recombinant granulocyte stimulating factor . Blood , 1993 . 81 3158 - 3163 . 7684625 . Autologous transplantation with peripheral blood mononuclear cells collected after administration of recombinant granulocyte stimulating factor GR Campbell , JH Campbell . Development of tissue engineered vascular grafts . Curr Pharm Biotechnol , 2007 . 8 ( 1 ): 43 - 50 . 17311552 DOI: 10.2174/138920107779941426 http://doi.org/10.2174/138920107779941426 . Development of tissue engineered vascular grafts G Chen , P Zhou , N Mei , X Chen , Z Shao , LF Pan , CG Wu . Silk fibroin modified porous poly(epsilon-caprolactone) scaffold for human fibroblast culture in vitro . J Mater Sci Mater Med , 2004 . 15 ( 6 ): 671 - 677 . 15346734 DOI: 10.1023/B:JMSM.0000030208.89523.2a http://doi.org/10.1023/B:JMSM.0000030208.89523.2a . Silk fibroin modified porous poly(epsilon-caprolactone) scaffold for human fibroblast culture in vitro SL Dahl , C Rhim , YC Song , LE Niklason . Mechanical properties and compositions of tissue engineered and native arteries . Ann Biomed Eng , 2007 . 35 ( 3 ): 348 - 355 . 17206488 DOI: 10.1007/s10439-006-9226-1 http://doi.org/10.1007/s10439-006-9226-1 . Mechanical properties and compositions of tissue engineered and native arteries NT Fang , SZ Xie , SM Wang , HY Gao , CG Wu , LF Pan . Construction of tissue-engineered heart valves by using decellularized scaffolds and endothelial progenitor cells . Chin Med J , 2007 . 120 ( 8 ): 696 - 702 . 17517187 . Construction of tissue-engineered heart valves by using decellularized scaffolds and endothelial progenitor cells G Gao , Y Li , D Zhang , S Gee , C Crosson , J Ma . Unbalanced expression of VEGF and PDGF in ischemia-induced retinal neovascularization . FEBS Lett , 2001 . 489 ( 2-3 ): 270 - 276 . 11165263 DOI: 10.1016/S0014-5793(01)02110-X http://doi.org/10.1016/S0014-5793(01)02110-X . Unbalanced expression of VEGF and PDGF in ischemia-induced retinal neovascularization J Gao , P Crapo , R Nerem , Y Wang . Co-expression of elastin and collagen leads to highly compliant engineered blood vessels . J Biomed Mater Res A , 2008 . 85 ( 4 ): 1120 - 1128 . 18412137 DOI: 10.1002/jbm.a.32028 http://doi.org/10.1002/jbm.a.32028 . Co-expression of elastin and collagen leads to highly compliant engineered blood vessels M Jevon , A Dorling , PI Hornick . Progenitor cells and vascular disease . Cell Prolif , 2008 . 41 ( Suppl. 1 ): 146 - 164 . 18181954 . Progenitor cells and vascular disease S Kaushal , GE Amiel , KJ Guleserian , OM Shapira , T Perry , FW Sutherland , E Rabkin , AM Moran , FJ Schoen , A Atala , 等 . Functional small-diameter neovessels created using endothelial progenitor cells expanded ex vivo . Nat Med , 2001 . 7 ( 9 ): 1035 - 1040 . 11533707 DOI: 10.1038/nm0901-1035 http://doi.org/10.1038/nm0901-1035 . Functional small-diameter neovessels created using endothelial progenitor cells expanded ex vivo JY Liu , DD Swartz , HF Peng , SF Gugino , JA Russell , ST Andreadis . Functional tissue-engineered blood vessels from bone marrow progenitor cells . Cardiovasc Res , 2007 . 75 ( 3 ): 618 - 628 . 17512920 DOI: 10.1016/j.cardiores.2007.04.018 http://doi.org/10.1016/j.cardiores.2007.04.018 . Functional tissue-engineered blood vessels from bone marrow progenitor cells JY Liu , HF Peng , ST Andreadis . Contractile smooth muscle cells derived from hair-follicle stem cells . Cardiovasc Res , 2008 . 79 ( 1 ): 24 - 33 . 18316325 DOI: 10.1093/cvr/cvn059 http://doi.org/10.1093/cvr/cvn059 . Contractile smooth muscle cells derived from hair-follicle stem cells WM Mahoney , SM Schwartz . Defining smooth muscle cells and smooth muscle injury . J Clin Invest , 2005 . 115 ( 2 ): 221 - 224 . 15690076 DOI: 10.1172/JCI200524272 http://doi.org/10.1172/JCI200524272 . Defining smooth muscle cells and smooth muscle injury N Mei , P Zhou , LF Pan , G Chen , CG Wu , X Chen , ZZ Shao , GQ Chen . Biocompatibility of poly (3-hydroxybutyrate- co -3-hydroxyhexanoate) modified by silk fibroin . J Mater Sci Mater Med , 2006 . 17 ( 8 ): 749 - 758 . 16897168 DOI: 10.1007/s10856-006-9686-8 http://doi.org/10.1007/s10856-006-9686-8 . Biocompatibility of poly (3-hydroxybutyrate-co-3-hydroxyhexanoate) modified by silk fibroin JM Melero-Martin , ZA Khan , A Picard , X Wu , S Paruchuri , J Bischoff . In vivo vasculogenic potential of human blood-derived endothelial progenitor cells . Blood , 2007 . 109 ( 11 ): 4761 - 4768 . 17327403 DOI: 10.1182/blood-2006-12-062471 http://doi.org/10.1182/blood-2006-12-062471 . In vivo vasculogenic potential of human blood-derived endothelial progenitor cells JM Miano , P Cserjesi , KL Ligon , M Periasamy , EN Olson . Smooth muscle myosin heavy chain marks exclusively the smooth muscle lineage during mouse embryogenesis . Circ Res , 1994 . 75 803 - 812 . 7923625 . Smooth muscle myosin heavy chain marks exclusively the smooth muscle lineage during mouse embryogenesis HM Nugent , ER Edelman . Tissue engineering therapy for cardiovascular disease . Circ Res , 2003 . 92 ( 10 ): 1068 - 1078 . 12775655 DOI: 10.1161/01.RES.0000073844.41372.38 http://doi.org/10.1161/01.RES.0000073844.41372.38 . Tissue engineering therapy for cardiovascular disease GK Owens , MS Kumar , BR Wamhoff . Molecular regulation of vascular smooth muscle cell differentiation in development and disease . Physiol Rev , 2004 . 84 ( 3 ): 767 - 801 . 15269336 DOI: 10.1152/physrev.00041.2003 http://doi.org/10.1152/physrev.00041.2003 . Molecular regulation of vascular smooth muscle cell differentiation in development and disease R Pettengell , GR Morgenstern , PJ Woll , J Chang , M Rowlands , R Young , JA Radford , JH Scarffe , NG Testa , D Crowther . Peripheral blood progenitor cell transplantation in lymphoma and leukemia using a single apheresis . Blood , 1993 . 82 3770 - 3777 . 7505124 . Peripheral blood progenitor cell transplantation in lymphoma and leukemia using a single apheresis CP Regan , I Manabe , GK Owens . Development of a smooth muscle-targeted cre recombinase mouse reveals novel insights regarding smooth muscle myosin heavy chain promoter regulation . Circ Res , 2000 . 87 363 - 369 . 10969033 . Development of a smooth muscle-targeted cre recombinase mouse reveals novel insights regarding smooth muscle myosin heavy chain promoter regulation S Sartore , M Scatena , A Chiavegato , E Faggin , L Giuriato , P Pauletto . Myosin isoform expression in smooth muscle cells during physiological and pathological vascular remodeling . J Vasc Res , 1994 . 31 61 - 81 . 8117862 . Myosin isoform expression in smooth muscle cells during physiological and pathological vascular remodeling LJ Schurgers , KJ Teunissen , MH Knapen , M Kwaijtaal , R van Diest , A Appels , CP Reutelingsperger , JP Cleutjens , C Vermeer . Novel conformation-specific antibodies against matrix gamma-carboxyglutamic acid (Gla) protein: undercarboxylated matrix Gla protein as marker for vascular calcification . Arterioscler Thromb Vasc Biol , 2005 . 25 ( 8 ): 1629 - 1633 . 15961706 DOI: 10.1161/01.ATV.0000173313.46222.43 http://doi.org/10.1161/01.ATV.0000173313.46222.43 . Novel conformation-specific antibodies against matrix gamma-carboxyglutamic acid (Gla) protein: undercarboxylated matrix Gla protein as marker for vascular calcification CM Shanahan , D Proudfoot , A Farzaneh-Far , PL Weissberg . The role of Gla proteins in vascular calcification . Crit Rev Eukaryot Gene Expr , 1998 . 8 ( 3-4 ): 357 - 375 . 9807700 . The role of Gla proteins in vascular calcification D Simper , PG Stalboerger , CJ Panetta , S Wang , NM Caplice . Smooth muscle progenitor cells in human blood . Circulation , 2002 . 106 ( 10 ): 1199 - 1204 . 12208793 DOI: 10.1161/01.CIR.0000031525.61826.A8 http://doi.org/10.1161/01.CIR.0000031525.61826.A8 . Smooth muscle progenitor cells in human blood JP Stegemann , H Hong , RM Nerem . Mechanical, biochemical, and extracellular matrix effects on vascular smooth muscle cell phenotype . J Appl Physiol , 2005 . 98 ( 6 ): 2321 - 2327 . 15894540 DOI: 10.1152/japplphysiol.01114.2004 http://doi.org/10.1152/japplphysiol.01114.2004 . Mechanical, biochemical, and extracellular matrix effects on vascular smooth muscle cell phenotype KH Wu , YL Liu , B Zhou , ZC Han . Cellular therapy and myocardial tissue engineering: the role of adult stem and progenitor cells . Eur J Cardiothorac Surg , 2006 . 30 ( 5 ): 770 - 781 . 16963271 DOI: 10.1016/j.ejcts.2006.08.003 http://doi.org/10.1016/j.ejcts.2006.08.003 . Cellular therapy and myocardial tissue engineering: the role of adult stem and progenitor cells X Wu , E Rabkin-Aikawa , KJ Guleserian , TE Perry , Y Masuda , FW Sutherland , FJ Schoen , JE Mayer , J Bischoff . Tissue-engineered microvessels on three-dimensional biodegradable scaffolds using human endothelial progenitor cells . Am J Physiol Heart Circ Physiol , 2004 . 287 ( 2 ): H480 - H487 . 15277191 DOI: 10.1152/ajpheart.01232.2003 http://doi.org/10.1152/ajpheart.01232.2003 . Tissue-engineered microvessels on three-dimensional biodegradable scaffolds using human endothelial progenitor cells ET Yeh , S Zhang , HD Wu , M Körbling , JT Willerson , Z Estrov . Transdifferentiation of human peripheral blood CD34 + -enriched cell population into cardiomyocytes, endothelial cells, and smooth muscle cells in vivo . Circulation , 2003 . 108 ( 17 ): 2070 - 2073 . 14568894 DOI: 10.1161/01.CIR.0000099501.52718.70 http://doi.org/10.1161/01.CIR.0000099501.52718.70 . Transdifferentiation of human peripheral blood CD34+-enriched cell population into cardiomyocytes, endothelial cells, and smooth muscle cells in vivo X Zhang , CB Baughman , DL Kaplan . In vitro evaluation of electrospun silk fibroin scaffolds for vascular cell growth . Biomaterials , 2008 . 29 ( 14 ): 2217 - 2227 . 18279952 DOI: 10.1016/j.biomaterials.2008.01.022 http://doi.org/10.1016/j.biomaterials.2008.01.022 . In vitro evaluation of electrospun silk fibroin scaffolds for vascular cell growth G Zund , Q Ye , SP Hoerstrup , A Schoeberlein , AC Schmid , J Grunenfelder , P Vogt , M Turina . Tissue engineering in cardiovascular surgery: MTT, a rapid and reliable quantitative method to assess the optimal human cell seeding on polymeric meshes . Eur J Cardiothorac Surg , 1999 . 15 ( 4 ): 519 - 524 . 10371132 DOI: 10.1016/S1010-7940(99)00068-8 http://doi.org/10.1016/S1010-7940(99)00068-8 . Tissue engineering in cardiovascular surgery: MTT, a rapid and reliable quantitative method to assess the optimal human cell seeding on polymeric meshes 10.1631/jzus.B0820257 Project supported by Shanghai Science Committee Fund for Key Research Project (No. 04JC14012) and Fudan University Med-X Fund, China 2008-08-22 2008-11-07 2008-11-11 2022-01-05 Copyright © 2008, Journal of Zhejiang University Science 2008 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 12 09