Expression, purification and characterization of a phyA^m-phyCs fusion phytase

Expression, purification and characterization of a phyA m - phyCs fusion phytase 1 2 first-author †E-mail:zoulkcn@hotmail.comwhongning@163.com †E-mail:zoulkcn@hotmail.comwhongning@163.com zoulkcn@hotmail.com 1 corresp ‡Corresponding Author ‡Corresponding Author †E-mail:zoulkcn@hotmail.comwhongning@163.com †E-mail:zoulkcn@hotmail.comwhongning@163.com zoulkcn@hotmail.com 3 1 1 4 4 4 1 College of Life Science, Bioengineering Research Center for Animal Disease Prevention and Control, Sichuan University, Chengdu 610065, China College of Life Science, Bioengineering Research Center for Animal Disease Prevention and Control, Sichuan University, Chengdu 610065, China Faculty of Biotechnology of Dujiangyan Campus, Sichuan Agricultural University, Dujiangyan 611830, China Faculty of Biotechnology of Dujiangyan Campus, Sichuan Agricultural University, Dujiangyan 611830, China College of Earth Science, Chengdu University of Technology, Chengdu 610059, China College of Earth Science, Chengdu University of Technology, Chengdu 610059, China College of Life Science, Sichuan Agricultural University, Ya’an 625014, China College of Life Science, Sichuan Agricultural University, Ya’an 625014, China The phyA m gene encoding acid phytase and optimized neutral phytase phyCs gene were inserted into expression vector pPIC9K in correct orientation and transformed into Pichia pastoris in order to expand the pH profile of phytase and decrease the cost of production. The fusion phytase phyA m - phyCs gene was successfully overexpressed in P . pastoris as an active and extracellular phytase. The yield of total extracellular fusion phytase activity is (25.4±0.53) U/ml at the flask scale and (159.1±2.92) U/ml for high cell-density fermentation, respectively. Purified fusion phytase exhibits an optimal temperature at 55 °C and an optimal pH at 5.5~6.0 and its relative activity remains at a relatively high level of above 70% in the range of pH 2.0 to 7.0. About 51% to 63% of its original activity remains after incubation at 75 °C to 95 °C for 10 min. Due to heavy glycosylation, the expressed fusion phytase shows a broad and diffuse band in SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). After deglycosylation by endoglycosidase H (EndoH f ), the enzyme has an apparent molecular size of 95 kDa. The characterization of the fusion phytase was compared with those of phyCs and phyA m . Expression PhyA m PhyCs Fusion phytase Pichia pastoris INTRODUCTION 1 Phytate ( myo -inositol hexakisphosphate) is the predominant form of storage of phosphorus in cereals, oilseeds and vegetables which are the major ingredients of animal feed (Reddy et al., 1982 1982 ; Wodzinski and Ullah, 1996 1996 ). Monogastric animals such as swine, poultry and fish are unable to utilize phytate due to the low levels of phytate-degrading enzyme activity in their digestive tracts and inorganic phosphate is added to the feed for the purpose of phosphorous supplementation (Bitar and Reinhold, 1972 1972 ; Common, 1989 1989 ). Hence non-metabolized phytate and unabsorbed phosphate pass through the intestinal tract and are excreted in manure causing phosphorous eutrophication. Furthermore, phytate also acts as an antinutritional factor in monogastric animals by chelating various metal ions needed by the animal, such as calcium, copper and zinc, therefore decreasing the dietary availability of these nutrients (Applegate et al., 2003 2003 ; Bohn et al., 2008 2008 ; Veum et al., 2006 2006 ). Phytase ( myo -inositol hexaphosphate phosphohydrolase, EC 3.1.3.8 or EC 3.1.3.26) hydrolyzes phytate, thereby releasing inorganic phosphate (Liu et al., 1998 1998 ; Wodzinski and Ullah, 1996 1996 ). Supplemental microbial phytase in meal diets for swine, poultry and fish effectively improves phytate phosphorus utilization by these animals, decreasing phosphorus excretion pollution (Augspurger et al., 2003 2003 ; Rutherfurd et al., 2002 2002 ; Olukosi et al., 2007 2007 ). There have been many reports on the cloning and expressions of phyA , phyC and appA phytases (Chen et al., 2004 2004 ; Rodriguez et al., 2000 2000 ; Kim et al., 1999 1999 ; Zinin et al., 2004 2004 ; Rodriguez et al., 1999 1999 ; Wang et al., 2005 2005 ; Wu et al., 2004a 2004a ; 2004b 2004b ; Han et al., 1999 1999 ). Recently phyA was site-mutated to phyA m and phyCs was synthesized without altering the protein sequence of phyC according to the Pichia pastoris codon usage bias because of the low productions of wild-type phyA and phyC phytases in P . pastoris , and we overexpressed them in yeast as an active and extracellular enzyme (Chen et al., 2005 2005 ; Zou et al., 2006 2006 ). The phyA ( phyA m ) phytase exhibits an optimum pH at 2.5 to 5.5, having a pH-activity profile ideally suited for maximal activity at low pH point (Chen et al., 2003 2003 ; Kim et al., 2006 2006 ). The phyC ( phyCs ) phytase exhibits an optimum pH around 6 to 9, suitable for neutral tracts and is more thermostable (Janne et al., 1998 1998 ; Kim et al., 1998 1998 ). However, the digestive tract of monogastric animals reveals pH between 2.0 to 7.0. For example, the stomach pH in many species is around 3.5, which happens to be the lowest activity point in the pH profile of phyC . And the small intestine pH is around 7.0, which is the lowest activity point in the pH profile of phyA . Thus a relatively high level of phytase supplementation is required in animal diets for adequate hydrolysis of phytate-phosphorus. Therefore the objective of the present study is to expand the pH profile of phytase. The aim can be circumvented by fusion of phyA m and phyCs phytases, which can be a feasible undertaking. Hence we report the overexpression of phyA m - phyCs fusion phytase in P . pastoris . The enzyme was purified to homogeneity to study the thermostability and the effect of pH and temperature on its activity. MATERIALS AND METHODS 1 Primers, plasmids and strains 2 The genes were amplified using pUC18- phyA m and pUC18- phyCs vectors as templates (Chen et al., 2005 2005 ; Zou et al., 2006 2006 ). To amplify the phyA m gene, the upstream primer 5′- TACGTA CTGGCAGTCCCCGCCTCGAG-3′ and the downstream primer 5′- CCTAGG TGGAGCAAAACACTCCGCCCAAT-3′ were designed with Sna BI and Avr II restriction enzyme sites at 5′ and 3′ terminals, respectively. To amplify the phyCs gene, an upstream primer 5′- CCTAGG GGTGGCGGGGGTTCTGGTGGCGGTGGTTCCGGTGGCGGGGGTTCCAAGCACAAGTTGTCTGACCCTTACCACTTCA-3′ was synthesized with Avr II restriction enzyme site and linker (Gly 4 Ser) 3 at the 5′ terminal, and a downstream primer 5′- GCGGCCGC TTACTTACCAGATCTGTCAGTCAACTTTCTTGGGTCGACTTGCTTGTTGAC-3′ was designed with Not I restriction enzyme site. The two PCR (polymerase chain reaction) fragments were cloned into pUCm-T vector (Sangon Bioengineering Co., Ltd., Shanghai, China), named pUCm- phyA m and pUCm- phyCs , respectively. Vector pPIC9K was from Introgen (Carlsbad, CA, USA) for expression. P . pastoris GS115 (Introgen, Carlsbad, CA, USA) was used as the host for expression, and Escherichia coli JM109 was used as the host for subcloning. P . pastoris PP-NP m -8 (Chen et al., 2005 2005 ) and P . pastoris PP9KCs3 (Zou et al., 2006 2006 ) were positive strains for phyA m and phyCs phytase expressions. Chemicals, enzymes and medium 2 Sodium phytate was purchased from the Sigma Chemical Co., Ltd. (St. Louis, MO, USA). Enzymes ( Taq DNA polymerase, restriction endonucleases), protein markers, Agarose Gel DNA Purification Kit Version 2.0 and DNA Ligation Kit Version 2.1 were purchased from TaKaRa (Dalian, China). Endoglycosidase H (EndoH f ) was from New England Biolabs (Beverly, MA, USA). All other materials were from the Sangon Bioengineering Co., Ltd. (Shanghai, China) and of analytical reagent grade. E . coli was cultured in Luria-Bertani (LB) broth (1% (w/v) tryptone, 0.5% (w/v) yeast extract, 0.5% (w/v) NaCl) or on LB agar plate. Yeast was cultivated in YPD (1% (w/v) yeast extract, 2% (w/v) peptone, 2% (w/v) dextrose, 2% (w/v) agar) medium. WBEG (wheat bran extract grown) and WBEI (wheat bran extract induction) media (Zou et al., 2006 2006 ) were used for shake-flask growing and induction. The expression strains were screened in MD (minimal dextrose) (1.34% (w/v) YNB (yeast nitrogen base), 4×10 −5 % (w/v) biotin, 2% (w/v) dextrose) and MM (minimal methanol) (1.34% (w/v) YNB, 4×10 −5 % (w/v) biotin, 0.5% (v/v) methanol). The WBSG (wheat bran silkworm grown) (100 g/L malt powder and 15 g/L wheat bran prepared as WBEG, 8 g/L silkworm chrysalis, 17.8 ml H 3 PO 4 , 0.62 g/L CaSO 4 , 12.1 g/L K 2 SO 4 , 9.9 g/L MgSO 4 ·7H 2 O, 2.75 g KOH) medium was used for phytase fed-batch fermentation (Xie and Wang, 2007 2007 ). Subcloning, construction of expression vector and transformation 2 The DNA manipulations were carried out by using standard procedures. The phyCs gene was obtained by digestion of pUCm- phyCs with restriction endonucleases Avr II and Not I, followed by agarose gel electrophoresis resolution and purification using TaKaRa Agarose Gel DNA Purification Kit Version 2.0. The purified phyCs fragment was ligated to the purified Avr II- Not I double-digested secretory expression vector pPIC9K using TaKaRa DNA Ligation Kit Version 2.1. The recombinant vector, pPIC9K- phyCs , was prepared by a plasmid miniprep kit (Ω), identified by Avr II- Not I double-digested restriction endonucleases analysis and sequenced. The phyA m gene was inserted into the vector pPIC9K- phyCs at Sna BI and Avr II sites. The construct, pPIC9K- phyA m Cs , was transformed into JM109 which was plated on LB medium containing 80 µg/ml kanamycin. The positive colonies were then grown to prepare DNA for transformation. P . pastoris GS115 strain was grown in the YPD medium and prepared for transformation according to the manufacturer instructions. Ten µg of plasmid DNA was linearized using Bsp EI and then transformed into yeast by electroporation. Roughly 10 µg linearized DNA pPIC9K- phyA m Cs and 80 µl competent GS115 cells were used for each transformation. Transformants were plated onto an MD plate and incubated at 28 °C for 3~4 d. All plates should be checked daily. Using a sterile toothpick, pick one colony and patch the His + transformant in a regular pattern on both MM and MD plates, making sure to patch the MM plate first. For testing the effectiveness of expression conditions, GS115 albumin and GS115 β-Gal were grown as control. Shake-flask cultivation 2 Single colonies were inoculated in 10 ml WBEG medium and grown at 28 °C and vigorously shaken at 250 r/min in a 100-ml flask for 16~20 h. Next, 3% (v/v) cells were inoculated into 100 ml WBEG medium. Cells were grown at 28 °C for 17~20 h and shaken at 250 r/min, then harvested by centrifugation at 5000× g and 4 °C for 5 min. The supernatant was decanted, and the pellet was resuspended and cultivated in a 500-ml flask containing 100 ml induction medium WBEI. Yeast growth was monitored by measuring the optical density at 600 nm ( OD 600 ). 1.5% (v/v) methanol was added every 12 h in order to induce phytase production. The culture supernatant after induction for 0, 24, 48, 60, 72, 84, 96 and 120 h obtained by centrifugation was assayed for phytase activity. Phytase activity assay 2 Phytase activity was assayed by measuring the rate of increase in inorganic orthophosphate (P i ) using the method as previously described (Janne et al., 1998 1998 ; Kim et al., 1999 1999 ; Tye et al., 2002 2002 ; Kim and Lei, 2005 2005 ). One unit of enzyme activity was defined as the activity that releases 1 μmol of inorganic phosphorus per minute from sodium phytate at pH 5.5 and 37 °C. Briefly, the crude enzyme was diluted in a suitable volume with 50 mmol/L sodium acetate buffer (2 mmol/L CaCl 2 , 10% (v/v) glycerol, pH 5.5). A reaction mixture containing 250 µl diluted enzyme preparation and 1 ml 2 mmol/L sodium phytate in 100 mmol/L sodium acetate buffer (2 mmol/L CaCl 2 , pH 5.5) was incubated at 37 °C for 30 min. Then the reaction was stopped by adding 1.25 ml of 15% (w/v) trichloroacetic acid (TCA). Blanks were run by incubating the enzyme samples with TCA for 30 min before adding the substrate. The released inorganic phosphate was measured by adding 2.5 ml of a color reagent. The color reagent was freshly prepared by mixing four volumes of 1.5% (w/v) ammonium molybdate in a 5.5% (v/v) sulfuric-acid solution and one volume of a 2.7% (w/v) ferrous sulfate solution. Following a 10 min color-development period, the liberated inorganic phosphate was measured at 700 nm. Fermentation 2 A single colony of transformant, found to produce the highest level of fusion phytase, was used for inoculation. A 30 ml YPD medium inoculated with fusion phytase-producing strain was grown in a 200-ml flask at 28 °C for 18 h. The 30 ml cultivated cells were then inoculated into a 2-L flask containing 270 ml YPD medium and grown at 28 °C for a further 16 h, following which 300 ml of the seed culture was added into a 5-L fermentor (East Biotech Equipment and Technology Co., Ltd., Zhenjiang, China) containing 2.7 L WBSG medium supplemented with 4% (v/v) glycerol as the sole carbon source. The temperature during fermentation was maintained at 28 °C and the pH was adjusted to 5.5 with 50% (w/w) NH 4 OH. Dissolved oxygen was measured and maintained at over 20% air saturation by regulating agitation to between 300 and 800 r/min. Aeration was maintained at 1.5~2 vvm. The fermentation was carried out in two phases, a glycerol batch culture phase for approximately 18~19 h, followed by a glycerol and methanol fed-batch induction culture phase for 96 h. The glycerol batch culture phase was maintained until the glycerol had been completely exhausted, as indicated by a sudden increase in the level of dissolved oxygen. During the fed-batch induction culture phase the 50% (v/v) glycerol was supplemented with a feeding rate of 12 ml/(L·h) for 12 h. The methanol feeding (100% (v/v) methanol with 12 ml/L PTM1 trace salts) was controlled and the methanol rate was maintained at 8 ml/(L·h). The fermentation product was taken periodically after induction for 0, 24, 48, 60, 72, 84 and 96 h for phytase activity assay and sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis. Purification of recombinant fusion phytase 2 All purification steps were carried out at 4 °C unless otherwise stated (Janne et al., 1998 1998 ; Zou et al., 2006 2006 ; Zhang et al., 2007 2007 ). The culture supernatant obtained by centrifugation at 5000× g for 10 min was supplemented with CaCl 2 to a final concentration of 2 mmol/L. Initial purification was achieved by mixing the culture supernatant with 3 volumes of cold (−20 °C) enthanol and the enzyme was precipitated overnight at −20 °C. The precipitate was pelleted by centrifugation at 5000× g for 20 min, and washed once with cold (−20 °C) ethanol and once with cold (−20 °C) acetone. Protein pellets were air-dried at room temperature and re-dissolved in 10 mmol/L Tris-maleate buffer (2 mmol/L CaCl 2 , 10% (v/v) glycerol, pH 6.0). The dissolved enzyme was performed by Chromatography Systems BioLogic LP and BioFrac TM Fraction Collector (Bio-Rad, California, USA). An aliquot of the dissolved sample was applied to a Q-sepharose fast flow (FF) anion-exchange column (Amersham Biosiences) equilibrated with Buffer A (10 mmol/L Tris-maleate, 2 mmol/L CaCl 2 , pH 6.0). The bound proteins were eluted with a linear NaCl gradient from 0 to 0.5 mol/L using Buffer B (50 mmol/L Tris-maleate, 2 mmol/L CaCl 2 , pH 6.0). A flow rate of 5 ml/min was used and protein elution was monitored by absorbance at 280 nm. The peak fractions were pooled and then dialyzed against 10 mmol/L sodium acetate buffer (2 mmol/L CaCl 2 , 10% (v/v) glycerol, pH 5.5). The portion after dialysis was concentrated by PEG (polyaethylene glycol) 20000 and stored at −20 °C for the next step analysis. The phyA m acid phytase and phyCs neutral phytase were purified as we reported previously (Chen et al., 2005 2005 ; Zou et al., 2006 2006 ). Characterization of recombinant fusion phytase 2 Enzyme activity assays were performed in defined buffers for various pH and temperature. The optimal pH was determined at 37 °C using buffers of 0.1 mol/L glycine-HCl (pH 2.0, 2.5 and 3.0), 0.1 mol/L sodium acetate (pH 3.5, 4.0, 4.5, 5.0 and 5.5), 0.1 mol/L Tris-maleate (pH 6.0 and 6.5), 0.1 mol/L Tris-HCl (pH 7.0, 7.5, 8.0 and 9.0) and 0.1 mol/L glycine-NaOH (pH 10.0, 11.0, 12.0 and 13.0). All buffers contained 2 mmol/L sodium phytate and 2 mmol/L CaCl 2 . The optimal temperature at pH 5.5 was measured at 16, 26, 37, 45, 50, 55, 60, 65, 70, 75, 80, 90 and 100 °C. The sample was incubated in a water bath for 30 min, then the reaction was quenched with 1.25 ml of 15% (w/v) TCA and the phytase activity was monitored as previously outlined. For enzyme thermostability tests the enzyme was incubated for 10 min in a water bath at seven different temperatures (37, 75, 80, 85, 90 and 95 °C) in a buffer of 50 mmol/L sodium acetate (2 mmol/L CaCl 2 , 10% (v/v) glycerol, pH 5.5) and then cooled to room temperature. The remaining phytase activity was measured at 37 °C, as described above. Deglycosylation 2 EndoH f was used to deglycosylate the fusion phytase expressed. Deglycosylation of purified enzyme was done according to the manufacturer’s instructions (New England Biolabs, Beverly, MA, USA). After the reaction the mixture was subjected to SDS-PAGE, using 8% (w/v) separating gels with a 4.4% (w/v) stacking gel. Gels were stained using Comassie brilliant blue R-250, methanol and glacial acetic acid. RESULTS 1 Construction of expression vector pPIC9K- phyA m Cs and its expression in P . pastoris 2 To create the construction of pPIC9K- phyCs , the phyCs gene was amplified by primers containing the linker (Gly 4 Ser) 3 before subcloning into the expression vector pPIC9K. The final expression vector pPIC9K- phyA m Cs , with the expected cloning junction sequence phyA m - phyCs gene, was selected and sequenced before transformation into P . pastoris . The expression vector containing the phyCs and fusion phyA m -phyCs genes in pPIC9K is shown in Fig. 1 1 . The Bsp EI-linearized pPIC9K- phyA m Cs was transformed into competent P . pastoris strain GS115. By linearizing the recombinant vector at the unique site located in HIS 4 region, Mut + recombinants were generated. In this study a total of 40 transformants appeared and one colony, which exhibited the highest phytase activity among the colonies examined, was selected for shake-flask expression. The fusion phytase amino acid sequence is shown in Fig. 2 2 . As shown in Fig. 3 3 , after 96 h of methanol induction, the yield of total extracellular phytase activity reached its highest value at (25.4±0.53) U/ml in WBEI medium at the flask scale. Purification and deglycosylation of the recombinant fusion phytase 2 The purification of recombinant phytase from WBEI medium by Q-sepharose FF anion-exchange chromatography is shown in Fig. 4 4 . When applied to an anion-exchange chromatography column at pH 6.0, the fusion phytase was eluted as a single peak at about 33 ml. The active protein fraction which showed higher phytase activity was pooled and combined. The sample was then dialyzed against a 10 mmol/L sodium acetate buffer (2 mmol/L CaCl 2 , 10% (v/v) glycerol, pH 5.5) and concentrated by PEG 20 000, prior to the measurement of enzyme properties. The expressed purified fusion phytase showed a broad and diffuse band rather than a protein with an apparent molecular size (Fig. 5c 5c ). To prove that the fusion phytase gene was expressed successfully in P . pastoris , the phyA m and phyCs phytases were also purified and deglycosylated by EndoH f . As shown in Figs. 5a, 5b 5a, 5b and 5c 5c , after deglycosylation by EndoH f the phyCs , phyA m and fusion phyA m - phyCs phytases had an apparent molecular size of 42, 51 and 95 kDa, respectively. The linker sequence encoding (Gly 4 Ser) 3 had a molecular size of about 2 kDa. Therefore the fusion phyA m - phyCs phytase gene was expressed successfully in P . pastoris as an active and extracellular enzyme. Characterization of recombinant fusion phytase 2 Fig. 6a 6a shows the effect of temperature on fusion phytase activity in defined buffers and the optimum temperature proved to be 55 °C. The relative activities of fusion phytase were 0.39, 0.50, 0.68, 0.75, 0.83, 1.00, 0.86, 0.78, 0.40, 0.25, 0.17, 0.10 and 0.06 at 16, 26, 37, 45, 50, 55, 60, 65, 70, 75, 80, 90 and 100 °C, respectively. As shown in Fig. 6b 6b , the purified fusion phytase had the optimum pH at 5.5 to 6.0, but the over 70% of enzyme activity remained in the range of pH 2.0 to 7.0 including three peaks at pH 2.0 to 2.5, pH 5.5 to 6.0 and pH 7.0. The relative activities of the fusion phytase were 0.67, 0.73, 0.49, 0.53, 0.60, 0.78, 0.94, 1.00, 0.99, 0.73, 0.74, 0.25, 0.08, 0.05, 0.02, 0, 0 and 0 at pH 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 9.0, 10.0, 11.0, 12.0 and 13.0, respectively. To test the thermostability, the activity of the fusion phytase was measured after incubation at various temperatures for 10 min. The relative activity of the enzyme remains at the levels of 1.00, 0.63, 0.63, 0.57, 0.56 and 0.51 at 37, 75, 80, 85, 90 and 95 °C, respectively. In conclusion, 51% to 63% of its original activity remained after incubation at 75 to 95 °C for 10 min, as shown in Fig. 6c 6c . The properties of phyA m acid phytase and phyCs neutral phytase were measured as we reported previously (Chen et al., 2003 2003 ; 2005 2005 ; Zou et al., 2006 2006 ). Fermentation 2 The high cell-density culturing was performed by feeding 50% (v/v) glycerol (12 ml/h for 12 h) after the initial amount of glycerol had been exhausted, as evidenced by the sudden increase in the level of dissolved oxygen. As shown in Fig. 7b 7b , for the glycerol batch phase the OD 600 was 129.8±4.25. The OD 600 reached 143.3±2.8 after the 24 h fed-batch induction cultivation. Maximum activity occurred within 84 h of post-induction and SDS-PAGE analysis indicated that phytase comprised the major protein present in the broth (Fig. 7a 7a ). The enzyme secreted into the medium was approximately (159.1±2.92) U/ml, with the cell density reaching approximately OD 600 =178.4±2.08. DISCUSSION 1 The most striking success in the study was in proving the feasibility of expanding the pH profile of phytase to enhance its catalytic efficiency in the digestive tract. As shown in Fig. 6a 6a , the phyA m acid phytase exhibited an optimum pH at 2.5 or 5.5, but it lost most of its activity when the pH was below 2.0 or above 6.5. The phyCs neutral phytase exhibited an optimum pH at 7.5 but it lost most of its activity below pH 4.0 or above 10.0. The optimum pH of the fusion phytase was at 5.5 to 6.0 and over 70% of relative activity of the enzyme remained in the range of pH 2.0 to 7.0 including three peaks at pH 2.0 to 2.5, pH 5.5 to 6.0 and pH 7.0. Only 1%, 40% and 8% relative activity of the phyA m phytase remained at pH 2.0, 6.5 and 7.0, respectively. The wild-type phyA phytase showed optimum pH at 4.6 and lost most of its activity at pH 2.0 and 6.5 (Chen et al., 2003 2003 ). But 79%, 71% and 84% of relative activity of the fusion phytase remained at pH 2.0, 6.5 and 7.0, respectively, higher than that of phyA m and wild-type phyA . Between pH 2.0 and 4.5, 70% to 92% of relative activity of the fusion phytase remained, which was higher than that of phyCs (0% to 25% of relative activity). Therefore the two phytases may have an interactive effect which we explored by crystal structure comparison (data not shown). However, the fusion phytase activity declined suddenly at pH 7.5, which was unexpectedly different from that of phyCs . Thus the fusion phytase could be not only suitable for the acid but also for the neutral digestive tracts of animals. Characterization of the recombinant fusion phytase revealed its higher relative activity and broader pH optimum, which was considered to be important for the application. The fusion phytase had the same optimum temperature at 55 °C as the wild-type phyA phytase, but its residual activities at 16 °C and 37 °C were higher than those of phyA m acid phytase and phyCs neutral phytase (Chen et al., 2003 2003 ; 2005 2005 ; Zou et al., 2006 2006 ). As shown in Fig. 6a 6a , the phyA m and phyCs phytases revealed optimum temperatures of 60 and 70 °C, respectively. Thermostability is a particularly important issue since feed pelleting is commonly performed at temperatures between 65 °C and 95 °C. About 51% to 63% of the original activity of fusion phytase remained after incubation at 75 °C to 95 °C for 10 min without a protective agent, which was more thermostable than phyA m phytase (Fig. 6c 6c ) and phyA mutant which retained 20% activity after being heated at 80 °C for 10 min (Zhang et al., 2007 2007 ). The expressed phyA m , phyCs and fusion phyA m - phyCs phytases showed a broad and diffuse band in SDS-PAGE due to the heavy glycosylation (Fig. 5 5 ) as described by Markus et al.( 1999 1999 ) and Zou et al.( 2006 2006 ). After deglycosylation by EndoH f , the phyA m , phyCs and fusion phyA m - phyCs phytases had an apparent molecular size of 51, 42 and 95 kDa, respectively. The glycosylation may have a number of effects on the properties of an enzyme, and it may have a positive effect on the thermostability (Yoshimasu et al., 2004 2004 ; Han and Lei, 1999 1999 ). As we previously reported, the glycosylation of P . pastoris phytase appeared to have increased with induction time and the glycosylated phytase resulted in the enhancement of thermostability (Zou et al., 2006 2006 ), so we deduced that deglycosylation may lead to the decrease of fusion phytase thermostability. The purified phytase showed streaking in SDS-PAGE, but after deglycosylation the streaking was eliminated as shown in Fig. 5 5 . Vuolanto et al.( 2001 2001 ) reported recombinant phyC neutral phytase activity of 48 U/ml with Bacillus subtilis expression system at a 2-L fermentor using a fed-batch protocol, which was lower than the phyCs phytase activity of 54 U/ml expressed in P . pastoris (data not shown). The modified phyA - sh acid phytase activity expressed in P . pastoris only reached 125 U/ml at a 5-L fermentor reported by Xiong et al. ( 2005 2005 ). In this paper, after an induction period of 84 h, the fusion phytase activity reached (159.1±2.92) U/ml at a 5-L fermentor using a fed-batch protocol. This is the first report of a fusion phytase gene in P . pastoris which has been shown to be suitable for high-level expression of various heterologous proteins, either intracellular or secretory. Under fermentation conditions P . pastoris has been shown to be able to grow to high cell densities capable of giving high levels of expressed protein with levels greater than 10 g/L reported (Cregg and Higginns, 1995 1995 ; Romanos, 1995 1995 ; André et al., 2006 2006 ). So there is a huge potential for the fermentation of fusion phytase if optimizing the cultivation conditions. According to our calculation, the cost of the BMMY (buffered methanol-complex medium), BSM (basal salts medium) and WBSG media was 7.5, 2.5 and 0.5 Yuan/L, respectively. Hence compared with the expensive BMMY and BSM (Xiong et al., 2005 2005 ) media, WBSG is an economical medium for the growth of P . pastoris and phytase expression. In conclusion, the phyA m - phyCs gene was successfully expressed as an active and extracellular phytase in P . pastoris . The fusion phytase shows an extended pH profile and favourable thermostability suitable for production and application. References N André , N Cherouati , C Prual , T Steffan , G Zeder-Lutz , T Magnin , F Pattus , H Michel , R Wagner , C Reinhart . Enhancing functional production of G protein-coupled receptors in Pichia pastoris to levels required for structural studies via a single expression screen . Protein Science , 2006 . 15 ( 5 ): 1115 - 1126 . 16597836 DOI: 10.1110/ps.062098206 http://doi.org/10.1110/ps.062098206 . Enhancing functional production of G protein-coupled receptors in Pichia pastoris to levels required for structural studies via a single expression screen TJ Applegate , DM Webel , XG Lei . Efficacy of a phytase derived from Escherichia coli and expressed in yeast on phosphorus utilization and bone mineralization in turkey poults . Poultry Science , 2003 . 82 ( 11 ): 1726 - 1732 . 14653467 . Efficacy of a phytase derived from Escherichia coli and expressed in yeast on phosphorus utilization and bone mineralization in turkey poults NR Augspurger , DM Webel , XG Lei , DH Baker . Efficacy of an E . coli phytase expressed in yeast for releasing phytate-bound phosphorus in young chicks and pigs . J Anim Sci , 2003 . 81 ( 2 ): 474 - 483 . 12643492 . Efficacy of an E. coli phytase expressed in yeast for releasing phytate-bound phosphorus in young chicks and pigs K Bitar , JG Reinhold . Phytase and alkaline phosphatase activities in intestinal mucosae of rat, chicken, calf, and man . Biochem Biophys Acta , 1972 . 268 ( 2 ): 442 - 452 . 4337334 . Phytase and alkaline phosphatase activities in intestinal mucosae of rat, chicken, calf, and man L Bohn , AS Meyer , SK Rasmussen . Phytate: impact on environment and human nutrition. A challenge for molecular breeding . J Zhejiang Univ Sci B , 2008 . 9 ( 3 ): 165 - 191 . 18357620 DOI: 10.1631/jzus.B0710640 http://doi.org/10.1631/jzus.B0710640 . Phytate: impact on environment and human nutrition. A challenge for molecular breeding CC Chen , PH Wu , CT Huang , KJ Cheng . A Pichia pastoris fermentation strategy for enhancing the heterologous expression of an Escherichia coli phytase . Enzyme and Microbial Technology , 2004 . 35 ( 4 ): 315 - 320 . DOI: 10.1016/j.enzmictec.2004.05.007 http://doi.org/10.1016/j.enzmictec.2004.05.007 . A Pichia pastoris fermentation strategy for enhancing the heterologous expression of an Escherichia coli phytase H Chen , HX Zhao , HN Wang . The research of phytase’s characteristics from gene engineering yeast . Microbiology , 2003 . 30 ( 3 ): 38 - 41 . (in Chinese) . The research of phytase’s characteristics from gene engineering yeast H Chen , HX Zhao , HN Wang . Increasing expression level of phytase gene ( phyA ) in Pichia pastoris by changing rare codons . Chinese Journal of Biochemistry and Molecular Biology , 2005 . 21 ( 2 ): 171 - 175 . (in Chinese) . Increasing expression level of phytase gene (phyA) in Pichia pastoris by changing rare codons FH Common . Biological availability of phosphorus for pigs . Nature , 1989 . 143 370 - 380 . . Biological availability of phosphorus for pigs JM Cregg , DR Higginns . Production of foreign proteins in the yeast Pichia pastoris . Can J Bot , 1995 . 73 ( Suppl. ): 5891 - 5987 . . Production of foreign proteins in the yeast Pichia pastoris Y Han , XG Lei . Role of glycosylation in the functional expression of an Aspergillus niger phytase ( phyA ) in Pichia pastoris . Archives of Biochemistry and Biophysics , 1999 . 364 ( 1 ): 83 - 90 . 10087168 DOI: 10.1006/abbi.1999.1115 http://doi.org/10.1006/abbi.1999.1115 . Role of glycosylation in the functional expression of an Aspergillus niger phytase (phyA) in Pichia pastoris Y Han , DB Wilson , XG Lei . Expression of an Aspergillus niger phytase gene ( phyA ) in Saccharomyces cerevisiae . Applied and Environmental Microbiology , 1999 . 65 ( 5 ): 1915 - 1918 . 10223979 . Expression of an Aspergillus niger phytase gene (phyA) in Saccharomyces cerevisiae K Janne , L Marko , N Paivi , K Nisse , A Juha . Isolation, characterization, molecular gene cloning, and sequencing of a novel phytase from Bacillus subtilis . Applied and Environmental Microbiology , 1998 . 64 ( 6 ): 2079 - 2085 . 9603817 . Isolation, characterization, molecular gene cloning, and sequencing of a novel phytase from Bacillus subtilis T Kim , EJ Mullaney , JM Porres , KR Roneker , S Crowe , S Rice , T Ko , AHJ Ullah , CB Daly , R Welch , 等 . Shifting the pH profile of Aspergillus niger phyA phytase to match the stomach pH enhances its effectiveness as an animal feed additive . Applied and Environmental Microbiology , 2006 . 72 ( 6 ): 4397 - 4403 . 16751556 DOI: 10.1128/AEM.02612-05 http://doi.org/10.1128/AEM.02612-05 . Shifting the pH profile of Aspergillus niger phyA phytase to match the stomach pH enhances its effectiveness as an animal feed additive TW Kim , XG Lei . An improved method for a rapid determination of phytase activity in animal feed . J Anim Sci , 2005 . 83 1062 - 1067 . 15827251 . An improved method for a rapid determination of phytase activity in animal feed YO Kim , JK Lee , HK Kim , JH Yu , TK Oh . Cloning of the thermostable phytase gene ( phy ) from Bacillus sp. DS11 and its expression in E . coli . FEMS Microbiology Letters , 1998 . 162 ( 1 ): 185 - 191 . DOI: 10.1111/j.1574-6968.1998.tb12997.x http://doi.org/10.1111/j.1574-6968.1998.tb12997.x . Cloning of the thermostable phytase gene (phy) from Bacillus sp. DS11 and its expression in E. coli YO Kim , JK Lee , BC Oh , TK Oh . High level expression of a recombinant thermostable phytase in Bacillus subtilis . Biosci Biotechnol Biochem , 1999 . 63 ( 12 ): 2205 - 2207 . DOI: 10.1271/bbb.63.2205 http://doi.org/10.1271/bbb.63.2205 . High level expression of a recombinant thermostable phytase in Bacillus subtilis BL Liu , A Rafiq , YM Tzeng , A Rob . The induction and characterization of phytase and beyond . Enzyme and Microbial Technology , 1998 . 22 ( 5 ): 415 - 424 . DOI: 10.1016/S0141-0229(97)00210-X http://doi.org/10.1016/S0141-0229(97)00210-X . The induction and characterization of phytase and beyond W Markus , P Luis , F Arno , R Roland , T Michek , K Alexandra , M Anke , L Martin , S Line , T Ursro , 等 . Biophysical characterization of fungal phytases ( myo -inositol hexakisphosphate phosphohydrolases): molecular size, glycosylation pattern, and engineering of proteolytic resistance . Applied and Environmental Microbiology , 1999 . 65 ( 2 ): 359 - 366 . 9925554 . Biophysical characterization of fungal phytases (myo-inositol hexakisphosphate phosphohydrolases): molecular size, glycosylation pattern, and engineering of proteolytic resistance OA Olukosi , JS Sands , O Adeola . Supplementation of carbohydrases or phytase individually or in combination to diets for weanling and growing-finishing pigs . J Anim Sci , 2007 . 855 ( 7 ): 1702 - 1711 . DOI: 10.2527/jas.2006-709 http://doi.org/10.2527/jas.2006-709 . Supplementation of carbohydrases or phytase individually or in combination to diets for weanling and growing-finishing pigs NR Reddy , SK Sathe , DK Salunkhe . Phytates in legumes and cereals . Adv Food Res , 1982 . 28 1 - 92 . 6299067 . Phytates in legumes and cereals E Rodriguez , Y Han , XG Lei . Cloning, sequencing, and expression of an Escherichia coli acid phosphatase/phytase gene (appA2) isolated from pig colon . Biochem Biophys Res Commun , 1999 . 257 ( 1 ): 117 - 123 . 10092520 DOI: 10.1006/bbrc.1999.0361 http://doi.org/10.1006/bbrc.1999.0361 . Cloning, sequencing, and expression of an Escherichia coli acid phosphatase/phytase gene (appA2) isolated from pig colon E Rodriguez , EJ Mullaney , XG Lei . Expression of the Aspergillus fumigatus phytase gene in Pichia pastoris and characterization of the recombinant enzyme . Biochemical and Biophysical Research Communications , 2000 . 268 ( 2 ): 373 - 378 . 10679211 DOI: 10.1006/bbrc.2000.2121 http://doi.org/10.1006/bbrc.2000.2121 . Expression of the Aspergillus fumigatus phytase gene in Pichia pastoris and characterization of the recombinant enzyme M Romanos . Advances in the use of Pichia pastoris for high-level expression . Curr Opin Biotechnol , 1995 . 6 ( 5 ): 527 - 533 . DOI: 10.1016/0958-1669(95)80087-5 http://doi.org/10.1016/0958-1669(95)80087-5 . Advances in the use of Pichia pastoris for high-level expression SM Rutherfurd , TK Chung , PJ Moughan . The effect of microbial phytase on ileal phosphorus and amino acid digestibility in the broiler chicken . Br Poultry Sci , 2002 . 43 ( 4 ): 598 - 606 . DOI: 10.1080/0007166022000004516 http://doi.org/10.1080/0007166022000004516 . The effect of microbial phytase on ileal phosphorus and amino acid digestibility in the broiler chicken AJ Tye , FKY Siu , TYC Leung , BL Lim . Molecular cloning and the biochemical characterization of two novel phytases from B . subtilis 168 and B . licheniformis . Appl Microbiol Biotechnol , 2002 . 59 ( 2 ): 190 - 197 . 12111145 DOI: 10.1007/s00253-002-1033-5 http://doi.org/10.1007/s00253-002-1033-5 . Molecular cloning and the biochemical characterization of two novel phytases from B. subtilis 168 and B. licheniformis TL Veum , DW Bollinger , CE Buff , MR Bedford . A genetically engineered Escherichia coli phytase improves nutrient utilization, growth performance, and bone strength of young swine fed diets deficient in available phosphorus . J Anim Sci , 2006 . 84 1147 - 1158 . 16612017 . A genetically engineered Escherichia coli phytase improves nutrient utilization, growth performance, and bone strength of young swine fed diets deficient in available phosphorus A Vuolanto , N von Weymarn , J Kerovuo , H Ojamo , M Leisola . Phytase production by high cell density culture of recombinant Bacillus subtilis . Biotechnology Letters , 2001 . 23 ( 10 ): 761 - 766 . DOI: 10.1023/A:1010369325558 http://doi.org/10.1023/A:1010369325558 . Phytase production by high cell density culture of recombinant Bacillus subtilis HN Wang , Q Wu , HX Zhao , LK Zou , SG Liu . Secretory expression of Bacillus subtilis phytase phyC in Pichia pastoris . Journal of Zhejiang University (Agric & Life Sci) , 2005 . 31 ( 5 ): 621 - 627 . (in Chinese) . Secretory expression of Bacillus subtilis phytase phyC in Pichia pastoris RJ Wodzinski , AH Ullah . Phytase . Adv Appl Microbiol , 1996 . 42 263 - 302 . 8865587 . Phytase Q Wu , HN Wang , LK Zou , HX Zhao , SG Liu . Expression of phytase phyC from B . subtilis in E . coli and its effect in enzymetic thermostability . High Technology Letters , 2004 . 14 ( 5 ): 23 - 27 . (in Chinese) . Expression of phytase phyC from B. subtilis in E. coli and its effect in enzymetic thermostability Q Wu , HN Wang , LK Zou , HX Zhao , SG Liu . Intrcellular expression of Bacillus subtilis phytase phyC in Pichia patoris . Journal of Jishou University (Natural Science Edition) , 2004 . 25 ( 1 ): 36 - 41 . (in Chinese) . Intrcellular expression of Bacillus subtilis phytase phyC in Pichia patoris ZW Xie , HN Wang . Preliminary study on flask fermentation condition of producing phytase by engineering bacterium . China Feed , 2007 . 3 13 - 16 . (in Chinese) . Preliminary study on flask fermentation condition of producing phytase by engineering bacterium AS Xiong , QH Yao , RH Peng , PL Han , ZM Cheng , Y Li . High level expression of a recombinant acid phytase gene in Pichia pastoris . Journal of Applied Microbiology , 2005 . 98 ( 2 ): 418 - 428 . 15659196 DOI: 10.1111/j.1365-2672.2004.02476.x http://doi.org/10.1111/j.1365-2672.2004.02476.x . High level expression of a recombinant acid phytase gene in Pichia pastoris MA Yoshimasu , T Tanaka , JK Ahn , RY Yada . Effect of N-linked glycosylation on the aspartic proteinase porcine pepsin expressed from Pichia pastoris . Glycobiology , 2004 . 14 ( 5 ): 417 - 429 . 14693908 DOI: 10.1093/glycob/cwh024 http://doi.org/10.1093/glycob/cwh024 . Effect of N-linked glycosylation on the aspartic proteinase porcine pepsin expressed from Pichia pastoris W Zhang , EJ Mullaney , XG Lei . Adopting selected hydrogen bonding and ionic interactions from Aspergillus fumigatus phytase structure improves the thermostability of Aspergillus niger phyA phytase . Applied and Environmental Microbiology , 2007 . 73 ( 9 ): 3069 - 3076 . 17351092 DOI: 10.1128/AEM.02970-06 http://doi.org/10.1128/AEM.02970-06 . Adopting selected hydrogen bonding and ionic interactions from Aspergillus fumigatus phytase structure improves the thermostability of Aspergillus niger phyA phytase NV Zinin , AV Serkina , MS Gelfand , AB Shevelev , SP Sineoky . Gene cloning, expression and characterization of novel phytase from Obesumbacterium proteus . FEMS Microbiology Letters , 2004 . 236 ( 2 ): 283 - 290 . 15251209 DOI: 10.1111/j.1574-6968.2004.tb09659.x http://doi.org/10.1111/j.1574-6968.2004.tb09659.x . Gene cloning, expression and characterization of novel phytase from Obesumbacterium proteus LK Zou , HN Wang , X Pan , T Xie , Q Wu , ZW Xie , WR Zhou . Design and expression of s synthetic phyC gene encoding the neutral phytase in Pichia pastoris . Acta Biochimica et Biophysica Sinica , 2006 . 38 ( 11 ): 803 - 811 . 17091198 DOI: 10.1111/j.1745-7270.2006.00231.x http://doi.org/10.1111/j.1745-7270.2006.00231.x . Design and expression of s synthetic phyC gene encoding the neutral phytase in Pichia pastoris 10.1631/jzus.B0720006 Project supported by the National Key Technologies R & D Program of China during the 10th Five-Year Plan Period (No. 2002BA514A-12), the Education Department of Sichuan Province (No. 2006B014) and the Innovative Fund for Distinguished Young Scholars of Sichuan Agricultural University, China 2007-12-07 2008-04-26 2022-01-05 Copyright © 2008, Journal of Zhejiang University Science 2008 Journal of Zhejiang University-SCIENCE B (Biomedicine and Biotechnology) 07 09